Transcript asmbl_45149

Sequence
Transcript Sequence for observation asmbl_45149 of TGE0019377:
CAGACATCTGTGCAGTGCCACCGAGTGGTGGGTGTCGCAGTAGTGTCTGCAGCCTGGACTTTGCAGAGTGAGAGCGTCTCGTAATGACTCTCCATGTTTTGGCCCCACAGCTCTATGAGAACTTCATCAGTGAGTTTGAACACAGGTAAAGCTCTTTTGTCAGCTTTTGACTTTGACAGTGAAAACACTGGTGCTTGTTGACAGCCAGCGACCAGTGGTTTCGTTTCAGGGTGAACCCTTTGTCCCTGGTGGAGATCATTCTGCACGTGGTCAGACAGATGACTGGTGAGTCCCACGCTGTGTCCAAAGGACTGGGCCAAGTAATGAGAATGATCTTGCCTTCTGACGGAAAGTATTGCATTCTAACTTACATTTTTATTGTATTTTATGTTTTAAACCTAAAAGTTGTCCTGGTTGGTAGAAACCAGTCTGTAAAGATGCTTCGCTGGTATTCTGCTGACTCTGTCCTGCTTTCTTCTCCAGATCCTAACGTGGCTCTCACTTTTCTGGAAAAGACTCGTGAAAAGGTGAAAAGCAGCGACGAGGCAGTGATCCTGTGTAAGACGGCCATCGGGGCTCTCAAGTTAAACATCGGAGACCTGCAGGTTACAAAGGAGACGATCGAGGCTGTGGAGGACATGCTGCACAGCCTCCCTGGCGTGACGTCCGTTCACAGCCGTTTCTACGACCTGTCCAGCAAATACTACCAGACGGTCGGGAACCACGCGTCCTACTACAAAGACGCCCTGCGGTTCCTGGGCTGTGTCGACATCAGGGACCTGCCAGCGCCCGAGCAGCGAGAGCGAGCATTCACGCTGGGACTGGCGGGACTTCTTGGTGACGGAGTTTTTAACTTTGGAGAACTCCTCATGCACCCCGTACTGGAGTCTCTGAGGGGCACTGACCGGCAGTGGCTGATCGACACCCTCTACGCCTTCAACAGTGGCAACGTGGAGAGGTTCCAGACGCTGAAAGCCGCCTGGGGCCAGCAGCCTGACTTAGCGGCCAACGAAGCCCAGCTTCTGAGGAAAATTCAGCTGTTGTGCCTCATGGAGATGACTTTCACACGACCTGCCAATCACAGACAACTCACTTTTGAAGAAATTGCCAAAAGTGCTAAAATCAGTGTGAACGAGGTGGAGCTGCTGGTGATGAAGGCGCTCTCGGTGGGGCTGGTGAAAGGGAGCATCGACGAGGTGGACGGGCGGGTCCACATGACCTGGGTGCAGCCCCGCGTGCTGGATCTGCAGCAGATCGCGGGCATGCGGGACCGCCTGGGCTTCTGGTGCAGCGACGTGAAGAGCATGGAGATGCTGGTGGAGCACCAGGCCCACGACATCCTCACTTAGCGCCTGCCTGCGGAGCTGCCTCCTGGCTGACGAAGCTGGCGGCTGGGTCTTCATTTAAGTGGGGTGGGGTGGGGCGGGGATTCTGTTTGGAGTAGGGACTGTTCTTGCTGTGAAAACAGGACTGTCATTGATGGGGGCCTGGTCACATGGAGAAGCCTCCTTGGTGGGTGTCTCCTGTCACCTACACTGGGGAAGAGTCACCGCATCTTAGGTGGTGAGGCAAGCACGTGTGTGGGGACACCCGCTCTAAGGCTGGTTTCTGTCCATCCCCCTGCTGCATGAGCGCTCAGTTCTGTAATAAACGCCTTTGCTTTGTCCCGTC