Transcript asmbl_45146

Sequence
Transcript Sequence for observation asmbl_45146 of TGE0019378:
GCCCCGCGTGTCGCGGCGCCGGAAGTGAGTGAGCACTTCCGGCGGCGCGGATTTCTCAGTGGTGCCGCTGTCCGGGGATCTTTCTGCCGAAATGAAGGACGTTCCCGGCTTCCTGCAGCAGAGCCAGAGCTCCGGGCCCGGCCAGGCCGCCGTGTGGCACCGCCTGGAGGAGCTCTACACGAAGAAGTTGTGGCATCAGCTGACACTTCAGGTTCTTGATTTTGTGCAGGACCCGTGCTTTGCCCAAGGAGATGGTCTCATTAAGCTCTATGAGAACTTCATCAGTGAGTTTGAACACAGGGTGAACCCTTTGTCCCTGGTGGAGATCATTCTGCACGTGGTCAGACAGATGACTGATCCTAACGTGGCTCTCACTTTTCTGGAAAAGACTCGTGAAAAGGTGAAAAGCAGCGACGAGGCAGTGATCCTGTGTAAGACGGCCATCGGGGCTCTCAAGTTAAACATCGGAGACCTGCAGGTTACAAAGGAGACGATCGAGGCTGTGGAGGACATGCTGCACAGCCTCCCTGGCGTGACGTCCGTTCACAGCCGTTTCTACGACCTGTCCAGCAAATACTACCAGACGGTCGGGAACCACGCGTCCTACTACAAAGACGCCCTGCGGTTCCTGGGCTGTGTCGACATCAGGGACCTGCCAGGTAACACGGGCGTCCAGTCCACATCCCGCAAGGACCTAGCCCTTGAGACACAGCTGCGAGCTGCTTGAGGCAGCAGGTCTGAGAAATCTCTCCAGCGCGTTCATCCCTTTTTGAAGAAATCCTGTGGGTTCGAGGGTGGGAG