Transcript asmbl_45144

Sequence
Transcript Sequence for observation asmbl_45144 of TGE0019377:
GCCCCGCGTGTCGCGGCGCCGGAAGTGAGTGAGCACTTCCGGCGGCGCGGATTTCTCAGTGGTGCCGCTGTCCGGGGATCTTTCTGCCGAAATGAAGGACGTTCCCGGCTTCCTGCAGCAGAGCCAGAGCTCCGGGCCCGGCCAGGCCGCCGTGTGGCACCGCCTGGAGGAGCTCTACACGAAGAAGTTGTGGCATCAGCTGACACTTCAGGTTCTTGATTTTGTGCAGGACCCGTGCTTTGCCCAAGGAGATGGTCTCATTAAGCTCTATGAGAACTTCATCAGTGAGTTTGAACACAGGTAAAGCTCTTTTGTCAGCTTTTGACTTTGACAGTGAAAACACTGGTGCTTGTTGACAGCCAGCGACCAGTGGTTTCGTTTCAGGGTGAACCCTTTGTCCCTGGTGGAGATCATTCTGCACGTGGTCAGACAGATGACTGGTGAGTCCCACGCTGTGTCCAAAGGACTGGGCCAAGTAATGAGAATGATCTTGCCTTCTGACGGAAAGTATTGCATTCTAACTTACATTTTTATTGTATTTTATGTTTTAAACCTAAAAGTTGTCCTGGTTGGTAGAAACCAGTCTGTAAAGATGCTTCGCTGGTATTCTGCTGACTCTGTCCTGCTTTCTTCTCCAGATCCTAACGTGGCTCTCACTTTTCTGGAAAAGACTCGTGAAAAGGTGAAAAGCAGCGACGAGGCAGTGATCCTGTGTAAGACGGCCATCGGGGCTCTCAAGTTAAACATCGGAGACCTGCAGGTTACAAAGGAGACGATCGAGGCTGTGGAGGACATGCTGCACAGCCTCCCTGGCGTGACGTCCGTTCACAGCCGTTTCTACGACCTGTCCAGCAAATACTACCAGACGGTCGGGAACCACGCGTCCTACTACAAAGACGCCCTGCGGTTCCTGGGCTGTGTCGACATCAGGGACCTGCCAGCGCCCGAGCAGCGAGAGCGAGCATTCACGCTGGGACTGGCGGGACTTCTTGGTGACGGAGTTTTTAACTTTGGAGAACTCCTCATGCACCCCGTACTGGAGTCTCTGAGGGGCACTGACCGGCAGTGGCTGATCGACACCCTCTACGCCTTCAACAGTGGCAACGTGGAGAGGTTCCAGACGCTGAAAGCCGCCTGGGGCCAGCAGCCTGACTTAGCGGCCAACGAAGCCCAGCTTCTGAGGAAAATTCAGCTGTTGTGCCTCATGGAGATGACTTTCACACGACCTGCCAATCACAGACAACTCACTTTTGAAGAAATTGCCAAAAGTGCTAAAATCAGTGTGAACGAGGTGGAGCTGCTGGTGATGAAGGCGCTCTCGGTGGGGCTGGTGAAAGGGAGCATCGACGAGGTGGACGGGCGGGTCCACATGACCTGGGTGCAGCCCCGCGTGCTGGATCTGCAGCAGATCGCGGGCATGCGGGACCGCCTGGGCTTCTGGTGCAGCGACGTGAAGAGCATGGAGATGCTGGTGGAGCACCAGGCCCACGACATCCTCACTTAGCGCCTGCCTGCGGAGCTGCCTCCTGGCTGACGAAGCTGGCGGCTGGGTCTTCATTTAAGTGGGGTGGGGTGGGGCGGGGATTCTGTTTGGAGTAGGGACTGTTCTTGCTGTGAAAACAGGACTGTCATTGATGGGGGCCTGGTCACATGGAGAAGCCTCCTTGGTGGGTGTCTCCTGTCACCTACACTGGGGAAGAGTCACCGCATCTTAGGTGGTGAGGCAAGCACGTGTGTGGGGACACCCGCTCTAAGGCTGGTTTCTGTCCATCCCCCTGCTGCATGAGCGCTCAGTTCTGTAATAAACGCCTTTGCTTTGTCCCGTC