Transcript asmbl_43951

Sequence
Transcript Sequence for observation asmbl_43951 of TGE0005782:
CTGACTCCTCCCGCTTCCGGTGCCGCCGTCGCCGTGCGTCCGTGTTGAGTTTCTGTCTTCGCTGAGCCGCTGTAGTCACCGCGGAGATGCCGCTGGAGAACTTGGAGGAGGAGGGTCTGCCCAAGAACCCCGACCTGCGCATCGCGCAGCTGCGCTTCCTGCTCAGCCTACCGGAGCACCGCGGGGACACGGCCGTGCGCGACGAGCTGATGGCGGCCGTCCGCGATAACAACATGGCTCCTTATTATGAAGCCTTGTGCAAATCCCTTGACTGGCAGATGGACATGGACCTGCTCAATAAAATGAAGAAGGCAAATGAAGAAGAGTTGAAACGGTTGGATGAGGAGCTGGAAGATGCAGAGAAAAATCTTGGAGAGAGCGAAATCCGCGATGCAATGATGGCAAAGGCAGAGTACCTCTGCCGGATAGGTGACAAGGAGGGTGCTCTGACAGCCTTTCGCAAGACGTATGACAAAACTGTTGCCCTGGGTCACCGACTGGATATTGTGTTCTATCTCCTTAGGATTGGCTTATTTTATATGGATAATGATCTCATCACACGAAACACAGAAAAGGCCAAAAGCTTAATAGAGGAAGGAGGAGACTGGGACAGAAGAAACCGCCTTAAAGTATATCAAGGTCTTTATTGTGTAGCTATTCGTGATTTCAAACAGGCAGCTGAACTCTTCCTTGACACTGTTTCAACATTTACATCCTATGAGCTCATGGATTATAAAACCTTTGTGACTTATACTGTCTATGTCAGTATGATTGCCTTAGAAAGACCAGATCTCAGGGAAAAGGTTATTAAAGGAGCAGAGATTCTTGAAGTGTTGCACAGTCTTCCAGCAGTTCGGCAGTATTTGTTTTCTCTCTATGAATGTCGTTACTCAGTTTTCTTCCAGTCGTTAGCTGTTGTGGAACAGGAAATGAAAAAGGACTGGCTTTTTGCTCCTCATTATCGGTACTATGTCAGAGAAATGAGAATTCATGCATACAGCCAGCTGCTGGAATCATATAGGTCATTAACCCTGGGCTATATGGCAGAAGCCTTTGGTGTTGGTGTGGAATTCATTGATCAGGAACTCTCCAGATTTATTGCTGCTGGGAGACTACACTGCAAAATAGATAAAGTGAATGAAATAGTGGAAACCAACAGACCTGATAGCAAGAACTGGCAGTACCAAGAAACTATCAAGAAAGGAGATCTGCTGCTAAACAGAGTTCAGAAACTTTCCAGAGTAATTAATATGTAAAACTATGTAAACAAAGGATTTCCTTTAGAGATAATTATTTCGAATTTTTATAGCTTACTCACTATGTGCCCAGTTCACTTGTATAAAATAAATACTGCATCGTTTCTTTC