Transcript asmbl_42608

Sequence
Transcript Sequence for observation asmbl_42608 of TGE0005676:
CAGCAGGAGGTGAGCGGCAGGCAGCAGAGGGTGACAACAATTTATAAAAGTGAAGAATTTTTAAAGAAGGTCACAAAAAGAGAAGGAAAATGCCGAAACCAATCAATGTAAGAGTAACCACAATGGATGCTGAGCTGGAATTTGCCATCCAGCCCAATACAACTGGCAAACAACTTTTTGACCAGGTGGTGAAAACAGTTGGTTTACGTGAGGTCTGGTTTTTTGGGCTACAGTATGTGGACAGCAAAGGTTATTCTACATGGCTTAAACTAAATAAAAAGGTGACACAGCAAGATGTTAAAAAAGAGAATCCTTTACAGTTCAAATTTAGAGCTAAATTCTTTCCTGAAGATGTTTCCGAGGAATTAATTCAAGAAATAACCCAGAGACTTTTCTTCTTGCAAGTTAAAGAAGCTATCTTAAATGATGAGATATATTGCCCACCAGAAACTGCAGTCCTTTTGGCTTCCTATGCTGTCCAAGCCAAGTATGGAGATTATAACAAAGAGATTCACAAACAAGGCTACCTGGCTAATGATAGACTCCTACCCCAGCGTGTTTTAGAACAACACAAACTGACAAAAGAACAGTGGGAAGAAAGAATACAGAACTGGCATGAAGAACATAGAGGAATGCTAAGGGAAGATTCTATGATGGAATACCTGAAGATTGCACAAGATCTAGAAATGTATGGAGTCAACTATTTTGAAATAAAAAATAAGAAAGGAACTGAATTGTGGCTAGGTGTTGATGCTTTGGGTCTGAATATTTATGAGCATGATGACAAGTTAACTCCTAAAATTGGTTTTCCCTGGAGTGAAATCAGGAATATTTCATTTAATGATAAAAAATTTGTTATAAAGCCAATCGACAAAAAGGCACCTGATTTTGTTTTTTATGCACCTCGTCTGAGAATCAATAAGCGGATTTTGGCCTTGTGTATGGGAAACCACGAACTATACATGCGAAGAAGGAAGCCTGATACTATTGAAGTACAACAGATGAAGGCGCAGGCTAGGGAGGAGAAACATCAGAAGCAGTTGGAAAGGGCACAATTAGAGAATGAAAAGAAGAAAAGAGAAATAGCAGAAAAGGAAAAGGAAAGAATAGAACGTGAAAAGGAAGAGCTAATGGAACGTTTAAGGCAAATTGAAGAACAAACAATGAAAGCCCAAAAAGAACTAGAAGAGCAGACTCGAAAAGCTCTAGAACTGGACCAGGAACGAAAACGAGCAAAAGAAGAAGCAGAAAGGCTTGAAAAGGAGCGTCGAGCTGCTGAAGAGGCCAAGTCTGCTATAGCAAAACAAGCTGCTGACCAGATGAAGAATCAGGAACAACTAGCAGCAGAACTTGCCGAATTCACTGCCAAGATTGCACTTCTGGAAGAAGCCAAGAAGAAAAAGGAAGAGGAAGCTACTGAGTGGCAACACAAAGCTTTTGCAGCCCAGGAAGACTTGGAAAAGACCAAAGAAGAGTTAAAAACTGTGATGTCTGCTCCACCTCCCCCTCCACCACCACCAGTCATTCCTCCAACAGAAAATGAAAATGATGAACATGATGAGAATAATGCCGAGGCTAGTGCTGAGTTATCAAATGATGGGGTAATGAACCACAGAAGTGAGGAGGAACGTGTAACAGAAACACAGAAAAATGAGCGTGTTAAGAAGCAACTTCAGGCATTAAGTTCAGAATTAGCCCAAGCCAGAGATGAAACCAAGAAAACACAAAATGATGTTCTTCATGCTGAGAATGTTAAAGCAGGCCGTGATAAATACAAGACTCTGCGACAGATTCGACAAGGCAATACAAAGCAACGTATTGATGAGTTTGAAGCAATGTGAGAGCTGTTATTTTGCATACATGTTCTTCATAAGCTGAACCACCAACAGAGAAAAGCAGGCCTTTGCAGATGTGATGGAATGCATCCCACCTTGCCAAAGCACTATACCAGTTTGACTGTGGTGTCTAAAAGACATATTTAAGGGGAGCTTTTCAACATTAAGGCAGTGTGATATCATCCTTGGTTTTCTTTTTCTTTTGGGCCAGGGAATGGAGAACAGTGTTCCATCACCTCCTTTCACAT