Transcript asmbl_42562

Sequence
Transcript Sequence for observation asmbl_42562 of TGE0005674:
GGGCTGGGAAGGCGGGTACCCCGAAATCGTCAAAGAGAACAAGCTCTTCGAGCACTACTACCAGGAGCTGAAGATCGTGCCGGAGGGCGAGTGGGACCAGTTCATGGAAGCGCTCAGGGAGCCCCTCCCGGCCACCTTAAGAATTACTGGTTACAAAAGCCACGCGAAAGAGATTCTCCATTGCTTAAAGAACAAGTATTTCAAGGAATTGGAAGACCTGGAGGTGGACGGTCAGAAAGTTGAAGTTCCACAACCCCTGAGTTGGTATCCTGAAGAACTTGCCTGGCACACAAATTTAAGTCGAAAAATCTTGCGAAAGTCTCCACAATTGGAAAAGTTTCACCAGTTTCTGGTTAGCGAAACCGAATCTGGAAACATCAGTCGTCAAGAAGCCGTTAGCATGATTCCACCGCTGTTGCTTAATGCTCATCCTCACCACAAGATCTTAGATATGTGTGCAGCGCCTGGATCGAAGACCACGCAGTTAATCGAAATGCTGCATGCCGACATGAGCGTCCCTTTCCCAGAGGGATTTGTCATCGCGAATGACGTGGACAACAAACGCTGCTATCTGCTCGTCCATCAGGCCAAAAGGCTGAGCAGCCCGTGCATCATGGTGGTCAACCACGACGCGGCCAGCATCCCGAGACTCAGCGTGGACGTGGGCGGGAGGAAGGAGATTCTCTTCTACGATCGCATCTTATGCGACGTCCCCTGCAGTGGAGATGGCACTATGAGAAAAAACATCGATGTTTGGAAAAAGTGGACCACGTTAAACAGCTTGCAGCTGCACGGCTTACAGCTACGCATCGCCACGCGGGGGGCTGAGCAGCTGGTAGAAGGCGGTCGGATGGTTTACTCCACGTGTTCCCTGAACCCTATCGAAGATGAAGCAGTCATAGCATCTTTACTGGAAAAAAGCGAAGGTGCCTTGGAGCTTGCTGACGTGTCTTCTGAGTTGCCGGGACTAAAGTGGATGCCTGGACTCACCCAGTGGAAGGTCATGACAAAAGATGGACAGTGGTTCGCATCGTGGGACGAGGTTCCTCACAGCAGACACACCCAGATCCGTCCCACCATGTTCCCACCGAAGGACGCGAACACGCTGCAGGCCATGCACCTAGAGCGGTGTCTTAGAATATTACCACATCATCAAAATACTGGCGGGTTCTTCGTGGCAGTATTAGTGAAAAAGTCTTCGATGCCATGGAATAAGCGTGCACCAAAGCTGCAGGGAGACTCTGCGGAGCTGAGGGCGCCTGCGCAGTCCAGCCCTGCAGGTCCCACGGGAGGGACAGCTGCGGGTCCCTCCGAGCTGGAAAGGACACCAGTCACTGGAATGGGTGACGCGGAAGTAATTGAAAGAACTGAGAACTTAGACGATAACGGAAACAAGAAAGACGGCGTGTGTGGTCCTCCTCCATCGAAGAAAATGAAGCTGTTTGGATTTAAAGAGGATCCGTTCGTGTTTATTCCTGAAGATGACCCATTATTTCCACCTATCCAGAAATTTTACGCTCTGGACCCTTCGTTCCCGAGGATGAATTTGTTGACGCGAACGACGGAAGGGAAGAAAAGGCAGCTCTACATGGTCTCCAAGGAGCTGCGGAACGTGCTGCTGAACAACAGCGAGCGGGTGAAGGTTATCAACACCGGGATAAAAGTCTGGTGTCGAAACAACAGTGGAGAAGAGTTCGATTGTGCTTTCCGGCTGGCACAGGAGGGAATATATACACTGTATCCATTTATTAACTCAAGAATCATTACTGTGTCGTTGGAAGACGTTAAAATCCTATTAACCCAGGAAAATCCATTTTTTAGAAAACTTAGCAGTGAGACGTACAGCCAAGCCAAGGACCTGGCCAAGGGGAGTGTCGTCCTGAAGTACGAGCCAGACCCCACGAAACCAGACACCCTGCAGTGTCCCATCGTGTTGTGTGGATGGCGGGGAAAGGCCTCAATTCGAACTTTCGTGCCCAAGAATGAGCGGCTGCATTACCTCAGGATGATGGGGCTGGAGGTGCTGGCAGAGAAGAAGAAGGAAGGGCCTGTCCTGACAGGCGACAGTGCCTCTGGCTCCGGGCCACCGGAGGACGAGGCGAGTGCCGACCGGGACGAAGAGCAGGCTGCCAGTGTGGACGGCGCAGGCGGTGACCCGGCCGGGGGTCCTGGGGCGTCTGCACCCCAGTCCAGAACTGCTGACCTGTAAAGCACGATTTTAACGGCTGGAAACAGACGGGATGGTAGAAGCTTCTGCGAGTGACCGCCGTCCTGCTGTCGCACGGCGTGTGAGGAAAGTATGTTTTCAGCTTGTTCGTTGCTCCTTTTACTTTGTTCTCTGGCGAAGCTGGGCCCAGCGCCTGCTGCCGGTGGGAGGCTTCGTGGTCGAGGTCTCGCTTCCATCAAGAAATGTCACTGCCCACGCAGAAACGTTCAGGTCCCTTCATTACACCTGCATTGGTCTTAAAGTCCAGTATTTCTTTTAATTATTATTTATAGGGAGGATCTGTATGTCCTTACGAGTCGTTGGAAACCATGCTGTAAGCTTTAATAATTGTATTAAGTTGCGTATCAGTGCGACATCGGTGCACAGTGGGTTAATATCCGGGCTGTCAGACGGCTTCTGTGCCTTTATAACAAAGAGTGAAATGTATCCTGTCATGTCAGAGAGACCTGCGTCATGAACTGTGAGGCTCATGAGGGTTTTATGTGCTTTTAGGAAACGAAGCACTTTGCAGTTTTAATTTTTTAATGGGGTTTGGGATGCCTGGAACGTTTAATTAAAGAGACTAATGAAATGTG