Transcript asmbl_42554

Sequence
Transcript Sequence for observation asmbl_42554 of TGE0019263:
CACTGCCATACGTTCCCGTGTCGTCCCTGGGCACGCCCCTGCACCGCTTAGAGGACGTGCTCCGTGTTGAGTTCTGAGGGTTTGCCTTTCCGATGAAGGAGTCGATAATCCTCGTTCTCTTGGGCGTCGTGGTTTCGTGGTCTCAGACTCTCTCCTATATTTCCATCATGAACACTAACCGCGGGTTTTATACCGGACACTTCCATCTTCCGAACCTGTCTCCCATCCTGTCTTTTCCCCCCGCATGCACACAGGGCACCTCTGGTATGACAGGCCCGGAGACCCCGCCCACTTTCTAGCCATGGAGGAGACCGGCCGGGAGGCTGTGGCGACCGCGGTGCAGAGGGTGGCCGGGATGCTCCAGCGGCCGGACCAGCTGGACAAAGTGGAGCAGTATCGCAGGCGAGAGGCCCGGAAGAAGGCCTCCGTGGAGGCCAGACTGAAGGCCGCGATCCAGTCGCAGTTGGATGGGGTGCGCGCGGGCCTGAGCCAGCTGCACAGCGCGCTGAACGACGTGAAAGATGTCCAGCAGTCCCTGGCCGACGTCAGCCAGGACTGGCGGCGGAGCATCAATACCATCGAGAGCCTCCGGGACGTGAAGGACGCCGTGGTGCGGCACAGCCAGCTGGCCGCTGCCGTGGAGAACCTCAAGAACATCTTCTCAGTGCCTGAGATTGTGAGGGACACGCAGGACCTCATAGAGCAGGGAGCGCTCCTGCAGGCCCACCGGAAGCTGATGGACCTGGAGTGCTCCCGGGACGGGCTGATGTGTGAGCAGTACCGCATGGACAGCAGGAACACCCGCGACATGACCCTCATCCACAGCTACTTCGGGAGCACGCAGGCTCTCTCTGACGAGCTGGCCAAGCAGCTATGGATGGTCCTGCAGAGGTCGCTGGTCACCGTCCGCCGTGACCCCACCTTGCTGGTGTCCGTTGTCAGGATCATCGAAAGGGAAGAAAAGATTGACAGGCGCATACTCGACCGAAAAAAGCAGACTGGCTTCGTTCCTCCCGGGAGGCCCAAGAGTTGGAAGGAGAAGATGTTTGCCGTCTTGGACAGAACCGTGACCACCAGAATCGAGGGCACACAGGCAGACACCAGGGAGTCCGACAAGATGTGGCTCGTCCGCCACCTGGAGATCATAAGGAAGTATGTCCTGGATGACCTCGTCGTTGCCAAGACCCTGATGGCACAGTGTTTTCCTCCGCATTATGAGATTTTCAGGAACCTCCTGAGCATGTACCACCAGGCGCTGAGCACGCGGATGCAGGAGCTTGCCTCGGAAGACCTGGAAGCGAATGAGATTGTGAGCCTGCTGACGTGGGTCCTGAACACCTACACGAGCGCAGAGATGATGGGGAACATGGAGCTGGCCCCAGAAGTGGACGTCAGCGCCCTGGAGCCTTTGCTGTCTCCACACGTGGTCTCTGAGCTGCTGGACACGTACATGTCGACTCTCACTTCGAACATCATTGCCTGGCTGCGGAAAGCTCTAGAAACAGACAAGAAAGACTGGGTAAAAGAGACGGAGCCAGAAGCCGACCAAGACGGGTACTACCAGACGACGCTCCCGGCCATCGTCTTCCAGATGTTCGAACAGAATCTTCAAGTTGCTGCTCAGATAAGTGAAGATTTGAAAACAAAGGTGCTCGTTTTGTGTCTTCAGCAAATGAATTCTTTCTTAAGTAGGTACAGAGACGAAGCCCAGCTGTACAAGGAGGAGCACCTGAGGGACCGGCAGCGCCCACACTGCTACGTGCAGTACATGGTCGCCATCATCAACAACTGCCAGACCTTCAAAGAATCCATCGTCAGTTTAAAGCGGAAGTATTTAAGAAGCGCAGGCGAAGACGGCGTGTCCGTGAGCCAGCCGAGCATGGACGGCGTCCTGGATGCCATCGCCGACGAGGGCTGCCGCAGCCTGCTGGAGGAGGTCTTCCTGGACCTGGAGCAACATCTCAGTGAGCTGATGACAAAAAAGTGGCTGTCGGGATCGAAGGCTGTAGACATCATCTGCGTCACCGTGGAAGACTATTTCAATGATTTTGCCAAAATCAAAAAGCCATATAAAAAGGGGCTCGGCGAAGAGGCGGATGGGTACTGCGACACGATCACGGCCGTCGCAGAGGTGATAAAGCTGACGGACCCGTCCCTGCTGTACCTGGAGGTCTCGACTCTGGTCAGCAAGTACCCGGACATCAGGGACGAGCACATCGGCGCGCTGCTTGCCATGCGAGGGGACGCCAGTCGGGACATGAAGCAGACCATCATCGAGACGCTGGAGCAGGGCACCACACAGGCGAGTCCGAACTACGTGCCCATCTTCAGGGACATTACGGTCCACAGTCTGAACGTCACCAAGCTCCTCAAATAACTTGTCTCGCCCCGAGTCTGCCCCACCCTCAGCAGTGCGTGACTCTGGAGGCCCAGCGCTCTGGTGGCAGGCCCTGGCCCTGGCCCTGGCCCCCCCCCGGGTCAAGAACGACGTTGCGAGCAGACCCAGGTGCCTGTGCCCCGCGCGCGTCGGCGCTTGTGTAGCTGCTGCTCAATAAAGGC