Transcript asmbl_42124

Sequence
Transcript Sequence for observation asmbl_42124 of TGE0005644:
CGCAGGCGCCGGGAGCCACTCTTGCCAGGTCCTCCCTTTCCAACAAGTACGGAAGGAACTTCCATAAAGTCATTTCCGGGAAGCGGGGTCGCGCTTTGTTCGCTGCAACATGGAGGCGAGTGGCGGAGCCGATGAGGCGGTTTCCGGGGAATTGGTGTCGGTGGCTCACGCTCTTTCTCTCCCCGCCGAGTCTTATGGCAACGATCCTGATATCGAGATGGCTTGGGCCATGAGAGCAATGCAGCACGCCGAAGTCTACTACAAGCTGATTTCATCAGTTGACCCACAGTTCCTGAAACTTACCAAAGTGGATGACCAAATCTATTCTGAATTTCGGAAAAATTTTGAGAATCTCAAGATAGATGTATTGGACCCAGAAGAGCTCAAATCGGTATCAGCTAAAGAGAAGTGGAGGCCATTCTGTTTGCAGTTTGATGGGGTTATAGAAGACTTCAACTATGGTACTTTGCTGCGACTGGATTGTTCTCAGGGCTACACTGAGGAAAACACAATCTTTGCCCCCAGGATACAATTTTTTGCCATTGAAATTGCTCGGAACAGGGAAGGCTATAACAAAGCAGTTTACGACAGTGTTCAGGACAAAGAAGACAAAGGGGCCAACAATGGCGAAAAAGAGAAAAGCGACAAAGGAGAAGAGAAAGAGAAAAAAGCCAAGAATGGAGTCAATGAAAGCGACGAAATAGCTATGTAAGGTAGACAGGGGACAGCACTCTAGAAACTGTGACTCGGCGGAGTCTACAAGTACCATGATGTTACTTGCACAGAACCCTACGGTTAAAGGTACGCCCTGTGCAGTCGAAGGCCATCTTTCTAGCCTAATAATCAGGAGCTGTTCTGATTGTTCTCTTGTAGGAATTGGCTTAAAGGCTATTAGTGGAGTCATAGTGGATTGTTTCTTGTTATATTTTTTCTTGTTATTTTTTTTCCACCAGTTACGTAAGAAATTTTGTAAATAAATTTCTTTTGGTTCTTA