Transcript asmbl_41831

Sequence
Transcript Sequence for observation asmbl_41831 of TGE0019238:
TGAACCTGTTTAGTGCTGCGCCTGACAAAAGCAAGCAGTCAAAATGGGACTTCCTTAAGGACAGGCCTGTCTTGTATCTGTTTCTCCAGCACCTAGCCTGGAATATACTTGGTGAAATTTTGGATGAAGCCATTAAATTAATTGCTTGCCATCATGAGCAGAAGTAAGCGTGACAGCAATTTTTATAGTGTAGAGATTGGTGATTCTACATTCACAGTCCTGAAACGATATCAGAATTTAAAACCTATAGGCTCAGGAGCTCAAGGAATAGTATGTGCAGCTTATGATGCCATTCTTGAAAGAAATGTTGCAATCAAGAAGCTAAGCCGGCCATTTCAGAATCAGACTCATGCTAAGCGGGCTTACAGAGAACTAGTTCTTATGAAATGTGTTAATCACAAAAATATAATTGGCCTGTTGAATGTTTTCACACCACAGAAATCCCTAGAAGAATTTCAAGATGTTTACATAGTCATGGAGCTCATGGATGCAAATCTTTGCCAAGTGATTCAGATGGAACTAGATCATGAAAGAATGTCCTACCTTCTCTATCAGATGCTGTGTGGAATCAAGCACCTTCACTCTGCTGGAATTATTCATCGGGACTTAAAGCCCAGTAATATAGTAGTAAAATCAGACTGCACTTTGAAGATTCTTGACTTTGGACTGGCCAGGACTGCTGGAACTAGTTTTATGATGACACCTTACGTAGTGACTCGCTACTACAGAGCACCAGAAGTCATCTTAGGAATGGGCTACAAAGAAAACGTTGACATTTGGTCAGTTGGGTGCATCATGGGAGAAATGATCAAAGGTGGTGTTTTGT