Transcript asmbl_41830

Sequence
Transcript Sequence for observation asmbl_41830 of TGE0019238:
CTCGCATTGCGCAGGGGCGGTTTCCTACGCAATGACGTGAGCAGGCGTGCGCAGTGACGGCTCGCGTCCCTGTTACTCAGCGGAGCGGCCGAGGCCGGACGACGCGGCCCGGGGCGCAGAGACGCGAGCAACGCTGGCTAACGGCTGTGGCGACCGCCCGGACGGCGCCGGTGTTTGCCGGTGGGCTTTTCTGTGGTCGTTCGCTGCGCTGCCGGCTTGGTGAAATTTTGGATGAAGCCATTAAATTAATTGCTTGCCATCATGAGCAGAAGTAAGCGTGACAGCAATTTTTATAGTGTAGAGATTGGTGATTCTACATTCACAGTCCTGAAACGATATCAGAATTTAAAACCTATAGGCTCAGGAGCTCAAGGAATAGTATGTGCAGCTTATGATGCCATTCTTGAAAGAAATGTTGCAATCAAGAAGCTAAGCCGGCCATTTCAGAATCAGACTCATGCTAAGCGGGCTTACAGAGAACTAGTTCTTATGAAATGTGTTAATCACAAAAATATAATTGGCCTGTTGAATGTTTTCACACCACAGAAATCCCTAGAAGAATTTCAAGATGTTTACATAGTCATGGAGCTCATGGATGCAAATCTTTGCCAAGTGATTCAGATGGAACTAGATCATGAAAGAATGTCCTACCTTCTCTATCAGATGCTGTGTGGAATCAAGCACCTTCACTCTGCTGGAATTATTCATCGGGACTTAAAGCCCAGTAATATAGTAGTAAAATCAGACTGCACTTTGAAGATTCTTGACTTTGGACTGGCCAGGACTGCTGGAACTAGTTTTATGATGACACCTTACGTAGTGACTCGCTACTACAGAGCACCAGAAGTCATCTTAGGAATGGGCTACAAAGAAAACGTTGACATTTGGTCAGTTGGGTGCATCATGGGAGAAATGATCAAAGGTGGTGTTTTGT