Transcript asmbl_41075

Sequence
Transcript Sequence for observation asmbl_41075 of TGE0005590:
CGCGCCTCCTCCCTGAGCTAACTGTGTGCGCCCCAGCCGCGCGCAGCTACTCGCGTCCGAGCCTCGCGCAAGCTCTCGTGTGTGCCGTGTCGTTTGGCGTCCACCTACCCCTCCGCTCTCCTTGCAAGTACCCCGCGCGTCTGCCACGCAGTCATGTCGTCCGGCAGCCGCGTTGCGCTGGTGACCGGCGCCAACAAGGGCATCGGCCTTGCCATTGTGCGCGACCTGTGCCGGCAGTTCTCCGGGGACGTGGTGCTCACAGCGCGGGACGCGGCGCGGGGCCAGGCAGCCGTGCAGCAGCTGCAGGCCGAGGGCCTGAGCCCGCGCTTCCACCAGCTGGACATCGACGACCTGCAGAGCATCCGCGCCCTGCGCGACTTTCTGCGCAAGGAGTACGGGGGCCTGGACGTGCTGGTCAACAACGCCGGCATCGCCTTCAAGTTAAAGGATCCCACACCGTTTCATATACAAGCAGAAGTGACAATGAAAACAAACTTTTTTGGTACCCGAGATGTCTCCACGGAACTACTGCCTCTCATGAAACCCCAAGGCAGAGTGGTGAATGTGTCCAGCAGCGTAAGCCTCACTGCTCTCAGGAGCTGCAGCCCAGAGCTGCAGCAGCAGTTTAGAAGCGAGACCATCAGTGAGGAGGAGCTGGTGGGGCTCATGAACAAGTTCGTGGAAGATGCGAAGAACGGTGTGCACCAGGAGGCGGGCTGGCCTACTAACGCCTACGGAGTGACGAAAATCGGTGTCACGGTCCTGTCCAGAATCCAGGCCAGGAACCTGAGCACGCAGAGGAAAGGGGACAAGATCCTCCTGAATGCCTGCTGTCCAGGGTGGGTGAGAACTGACATGGCGGGATCCAGAGCCCCCAAAAGCCCGGAGGAAGGCGCAGAAACCCCCGTGTACTTGGCCCTTTTGCCCTCGGATGCTACAGAGCCTCATGGGCAGTTTGTTAAGGAGAAAAAAGTTGAACAGTGGTGAGTGAGCTCAACCCATAGAGCTCCATCCATAGTTTCCATGTTGTACCCGTCCTGATTTGATCCAAAGTGTGTTTAACACAGTCAAAACTATCCCTACCAAGGATTCACTTTGAATTGTCTACCAATTCTATGAAGCCTTTTGTAATTTGTGATGTTTATGCAGTTCTCTGTGATATTCTATAGGGAGAACACATGTGTTAGTGCTGATAATAACGAATTAAAATCAATAGAGG