Transcript asmbl_41001

Sequence
Transcript Sequence for observation asmbl_41001 of TGE0005584:
GCAGATACTACAACTCCCAGAATCCTGAGCGAGCCAGCTCCCGCGTCGCGTTTTTGTTGCGGCTGCCGGGCCTGATCAGTCCAGTGGGACACGAACGGAGATAGTGTACGGGATTGTTCTCTCTGCGGGGCCTCAAGGGAAAAGGAATAGCTATGTCATCCTTGATCAAAAAGGTGATCAGCACCGTGAAAGCCCCAGGGGCCATTGGTCCCTACAGTCAAGCTGTGTTAGTCGACAGGACCATTTACATTTCAGGACAGATAGGCATGGACCCTTCAAGTGGACAACTTGTGCCAGGAGGTGTGGTAGAAGAAGCTAAACAAGCTCTTACAAACATGGGTGAAATTCTGAAAGCTGCAGGCTGTGACTTCACTAATGTGGTAAAAACAACTGTTTTGCTGGCTGACATAAATGACTTTGGTACTGTCAATGAAATCTATAAACAGTATTTCAAAAGTGATTTTCCTGCAAGAGCTGCTTACCAGGTTGCTGCTTTGCCCAAAGGAGGCCGTGTTGAGATTGAAGCAGTAGCTATCCAAGGCCCTCTCACAACAGCATCACTCTAAGCAGGCCTAATAATATTTAGTCTGGAATATTAATAATGTTTTAAAATATATTAATTTTTATAATCAATGTTGGAAAGTATAAGACAGACTAAAATATCTGAAGTATAAAGAAAATACCATATAATAAGGGGACTTGAACATGAATTACAGATGAAATGATGAATCCACTCACTGATGTTATAAAGAACAGTTATGCATGCCCACATGCCTGGATGCGAGAGGAGACACATTGCGTTACGTAGTCACTCAAACAAATAAAAGGAAATAACACTCAGGAAATATGAGTTACTATTCCTGAGAAATAGTGAAGAGTACATGTATTAGTTAAATACTAATAATTTGATGGTGTGAAATATTTAGTTCTCATGTCAAATATGTGATTCTGCTTTTACTTGAGTAAAATTAAAGATTTAAGTTTGAATGGTAGACGTAAAGGCAAAAAAAAGTGGACCAAAATTGTATATAGCTAATATTTTTCTAATGGA