Transcript asmbl_39924

Sequence
Transcript Sequence for observation asmbl_39924 of TGE0005521:
CTAGAATCTGGGGCTCAACGTTGGTCTCTTGGGAATGTGGAGAGCTGGCAGCATGTCGGCGGAGCTGGGAGTCGCGTTCGCTCTGCTGGCAGTGAACGAGCGCGTGCAGCAGGCGGTGGCACGGCGGCCGCGGGATCTCCCGGCCATCCAGCCCCGGCTAGTAGCCGTCAGCAAAACCAAACCTGCAGACATGGTGATTGAGGCCTATAGTCATGGCCAGCGCTCTTTTGGGGAGAACTATGTTCAAGAACTGCTAGAAAAAGCATCAAATCCTAAAATTCTGTCTTCATGTCCTGAGATCAAATGGCACTTCATTGGCCACCTGCAGAAACAAAATGTCAACAAATTGATGGCTGTCCCCAATCTCTTCATGCTGGAAACAGTGGATTCTATGAAGTTGGCAGACAAAGTCAACAGTTCATGGCAGAAAAAAGGTTCCTCTGAAAGGTTAAAGGTTATGGTCCAAATTAACACCAGTGGAGAAGAGAGTAAACATGGCCTTCTACCTTCAGAGACAGTAGCCATGGTGGAACACATAAATACCAAGTGCCCCAGCCTGGAATTTGTGGGGCTGATGACCATAGGAAGCTTTGGGCATGATCTTAGTCAAGGACCAAATCCAGACTTCCAGATGTTATTGTCTCTCCGGGAAGAGCTATGTAAAAAACTGAACATCACTGCTGACCAGGTTGAGCTGAGCATGGGCATGTCCATGGACTTCCAGCATGCAATTGAAGTAGGATCTACGAATGTCCGCATTGGAAGCACCATTTTTGGAGAGCGAGATTACTCAAAGAAGCCTGCCCTGGACAAGTCCGCAGCAGACCTGAAGGCCCCCATAGAAGTAACACAGGCACACTGAGCCAAGGAACAGCCAGCAGTGGCTCACAGCCTGTGGCCCTGTCCAGGAAGACTAACTATGCA