Transcript asmbl_39903

Sequence
Transcript Sequence for observation asmbl_39903 of TGE0005515:
TGGGACTGCGGGGCTGGAGGCCTGGAATCCTGGGTCCAGGCCAGAGATCTGACCCGTGGTTGGTGTCCCCCGAACCCTCAGCGTGGCCCGTCTTGTCCTCGCCATGAGGCCGCAGCAGGCGCCGGTGTCCGGGAAAGTATTCATTCAGCGAGACTACAGCAGTGGCACACGCTGCCAGTTCCAGACCAAGTTCCCCGCGGAGCTGGAGAACCGGATTGATAGGCAGCAGTTTGAAGAAACAGTTCGAACTCTAAATAACCTTTATGCAGAAGCAGAGAAGCTTGGGGGTCAATCATATCTTGAAGGCTGTTTGGCTTGTTTAACAGCATATACCATCTTCTTATGCATGGAAACTCATTATGAGAAGGTTCTGAAGAAAGTCTCCAAATACATTCAAGAGCAGAATGAGAAGATATATGCTCCCCAAGGCCTCCTCCTGACAGATCCCATTGAGAGAGGACTTCGAGTTATTGAAATTACCATTTATGAAGACAGAGGCATGAGCAGTGGAAGATAAACATAGAATTAAAGATCCCAACTCTAGCTGGGACCCTCATCTGTCCACTGGCCAATCGCAGAGTGTCCCCTACCTCCTCTCCAGAGCGTCATTCCTTTGTATCTGCTGCCAGAGCCACGGTGCCATTTCCTCCAAGGACTAACTTTCTAATATTCCACACCTGGAGTGACCTCTCGTCGCTCAGCATCCACTTTATGTCTCCAAATTGTGTAGGACTCTGTAATCTTTTGATTAGTTTCTGAGAAAACACAATGAAGCATTTCACTTTTTTATTCAAAGCCATTAATAAAATATGTAGTTAGTCAGCCCAACTCAAAGTTTATTTCTTATCTGCCACCAGTCCCAAATGGTTCTCGTCATTCCTTGGCCCAGCTTCCCAGGTGGCTGTAGACTTCAAAGTGATGTTAGCCAGTGTTCAGTCTTATTCCCCAAATAAAATGCTTTACTCCAGGATTTCAGTGAAGGGTAGGCTGTGTCTGTGGTTTTGCTAATGCATGTCCCAGATTTCAAAGAACTACCAGTTTTGCCATGACTCAAATCTTAAAGATGTTTCTGCCATTCAGTTTCTCAAACTGAAGCTCATTGGAAAAATAATGTGTAATGTTATTTGTTTTATTATAGCAATTATTCCTAATTAAAGCAGTATTAAATGCAATTTCCAGTTATTTTTCTTTGGAGAATTTTGTTATTATTGTATTACCTTGAATGTTGAGAAGATGTGGTATGTGTTGCTTGTTCCTTACAAAAATAAGCACAATAAAGTGGATGCTAAACCATCAGACACATAAATGTCCCTGCTGTTTCCCTGAAAGTGTAATAAGCAAGTATAATAAATATTTTAATTATAGTTTTGTTATAAATATAACTTATGAGAAAAAATTTGATAGGAATAATACTGTATATTGCTAATTTTTAACTATCTCTGCTGGCAAACCTTATTCATAGACTCTCATATACAGTATTCAATGCACAGAAATCTTATGATTGGTTCAAGTACAGTAAGTTAAGTAATTTCCAACTAAAACTCAAGTCTGAGTCAACATTTCTAGTTCCTTTGGCCGTATGTTCTCAGCATCAGGGCTTCTATGCCCTTCATTCACACATGGGCTTTGAAAGAGAGCACCATATTTGGGAGAGAGTTAAGAAATATTTTAGGAGAGAATGAAACAGTTAAGTTTTACTTTCAGAGATATTGTAGGTGCTAATACTGGATTTAATCTTTCATATGTAATTCCTTTTATGGATCTGTTAGTTATTCAATAAATTCCATAGGTCTGTGTAATATTTTAATTGTATAAAACTCCTTTGTTACTTTATAGCCTGAAATAATGTCTGTCTGCCTTTTAAACCCATTGCAATAACTTTGCTGAAATATTAACACATTAGTAAAACTTTTCTT