Transcript asmbl_38950

Sequence
Transcript Sequence for observation asmbl_38950 of TGE0005446:
GGCATGATGGCTCATTCCCCACCTGTGTCACTTTTCCTAGGTCAGGAGGAAAGTGGGTCTGGCCTTGGGTCTCTGGGAATGGCATGCCTATGTGCAAAGAAACCTGCAGGGCTGGGGTGGAACTGTTTGGCAGGCATGTGTCTGAGTCCAGAATGAGAGCAGGGTTGGAGGTGGACACACAGTGGTTGCTAAACCCACTTAGCTAAACACACTCAGCCGCGTGACCCTGCTGTGTCAGCCCCACTGGGTGCTGGGCATGTCCCAGCCCTCAGGGATATAGCAGAGCCCTTTGAAAGACATCATCCATGCCTGAGTCCGAGAGTGGCTGGATTTTGTGTGGCTGTGCCAAGCACAGGGAGGACAGGCCAAGAGCCTCTCCTCCCCGGAGACCTGATGTAAGCCCTGGTGACCAGGAAAGGCTCCGAGCTGAGACTTGGAGGCTGAAGAGAGAGGGTTGTGTGTTCTTGAGATCCCTCACCAATAGGGTGAGGTTACCTTAACGCAGGTGGCAGGTTTGGGTGTGAACTTGGATCCTTGTGGTCCCAGGGTGGGATTGTTGCTGCTTTGCCACGTTGGCATCTGTCACAGTTGTTCTGAGGAACGGTGGCAGCTGGGCAGGTTTGGGAGACACGGTGTTTTCTCTGCCAGCCGTCACCGGGCCGGGAGGAAGGCAGGCCTCCCTGCAGACCCCCAGGGTTCCGGTGACGGTTTGGCTGGGCACCAAAGTCCGTTCCTTCCTCCTTCCCTCAGGAGTTGTGTCCACAGTGGTCCCAGACTCCGCCCACAAGCTGTTCATTGGGGGCCTTCCCAACTACCTGAACGATGACCAGGTGAAAGAGCTGCTGACATCATTCGGGCCTCTCAAGGCCTTCAACCTGGTTAAGGACAGCGCGACTGGGCTCTCCAAGGGCTACGCCTTCTGTGAGTACGTGGACATCAACGTCACGGATCAGGCTATTGCGGGGCTGAATGGGATGCAGCTGGGTGACAAGAAACTGCTGGTCCAGAGGGCGAGTGTGGGAGCCAAGAATGCCACGCTGAGCACCATCAACCAGACCCCTGTGACCCTGCAAGTGCCCGGCTTGATGAGCTCCCAGGTGCAGATGGGTGGCCACCCGACCGAGGTCCTGTGCCTCATGAACATGGTGCTGCCTGAGGAGCTGCTGGACGACGAGGAGTATGAGGAGATCGTGGAGGACGTGCGTGATGAGTGCAGCAAGTATGGGCTGGTCAAGTCCATTGAGATCCCCCGGCCCGTGGATGGTGTCGAGGTGCCCGGCTGTGGAAAGATCTTCGTGGAGTTCACCTCTGTGTTTGACTGCCAGAAAGCCATGCAGGGCCTGACGGGTCGCAAGTTCGCCAACAGAGTGGTTGTCACAAAATACTGTGACCCCGACTCTTACCACCGCAGGGACTTCTGGTAGAGGCGGTGGGGGAGGGTGGGGCCGGGCTGGCGTAGGGCTTCTGCCCTGCCACCCCCCCTTTTTCCCCCTCTGAAGACATGGGCAGAGGAGTGACAGCCGAGTGACAGCCGGCAGCAACTGGAATGGCAGCAATTTAAGG