Transcript asmbl_37784

Sequence
Transcript Sequence for observation asmbl_37784 of TGE0003333:
TACGCATTGATATGATTGGCCGGCGAAGAGTGGCTCTCTTTTCCTCCTTGGCTGCTTGAAGGCCTTCTGCCATCATGAATGACACAGTAACTATCCGGACCAGGAAGTTCATGACCAATAGGCTACTTCAACGGAAACAAATGGTCATCGATGTTCTTCATCCTGGAAAGGCAACAGTACCTAAGACAGAAATTCGGGAAAAACTAGCCAAAATGTACAAGACCACACCAGATGTCATTTTTGTATTTGGATTCCGAACCCATTTTGGTGGTGGCAAGACAACCGGCTTTGGCATGATTTATGATTCCTTGGACTATGCAAAGAAAAATGAACCCAAACATAGACTTGCAAGACATGGCCTTTATGAGAAGAAAAAGACCTCAAGAAAACAGCGAAAGGAACGCAAGAACAGGATGAAGAAAGTTAGAGGGACTGCAAAGGCCAATGTTGGTGCTGGCAAAAAGTGAGCTGGAGATTGGACAACAGAAGGAGTAAAGATTCGTCAGTGACTCTGGTGATCAGATTCTTCATGAGAGGATTAATAAACTAATAACTTTTA