Transcript asmbl_37144

Sequence
Transcript Sequence for observation asmbl_37144 of TGE0005318:
CAACAAAGCCCGAAAGACGGAGCCCGAGCCTCGGGGGCTCCTTAGCAACGGGCCGGGGCGGGAGTTCCATGGAGACTGGGGAGCGCGCCCGCCTCATCATCATCCTTGCCCTCCAGCTTATCCTTCGCGTCCGACGCAACCGGCAGCACTGCTGCCGCCGCGTCCTCTGCCACCGCCACCTTTTCCCACGGATGTGATCTTCGTGGTGGGAAGCTAAGTTTTTAAACTACCCCAATGGATGCAGACAGTGATGTTGCATTGGACATTCTGATTACAAATGTAGTCTGTGTTTTTAGAACAAGATGTCATTTGAACTTAAGGAAGATTGCTTTGGAGGGAGCAAATGTAATTTATAAGCGTGACGTTGGAAAAGTATTAATGAAGCTTAGAAAACCTAGAATTACAGCTACAATTTGGTCCTCAGGAAAAATTATTTGCACTGGAGCAACAAGTGAAGAAGAAGCTAAATTTGGTGCCAGACGTTTAGCTCGCAGTCTCCAAAAACTAGGTTTTCAGGTAATATTTACAGATTTTAAGGTTGTTAACGTTTTAGCAGTATGTAACATGCCATTTGAAATCCGTTTGCCAGAATTCACAAAGAACAATAGACCTCATGCCAGTTATGAACCTGAACTTCATCCTGCTGTGTGCTATCGGATAAAATCTCTAAGAGCTACATTACAGATTTTTTCAACAGGAAGTATCACAGTAACAGGGCCCAATGTAAAGGCTGTTGCTACTGCTGTGGAACAGATTTACCCATTTGTGTTTGAAAGCAGGAAAGAAATTTTGTAATTCATCACTTAATTGGTTAGAATCCCTAACTGAGCACCTTTTAAAACCTGCTGCACATTGGACTCAAAACAGAAGGAAAACTGGACCAACAGCAATCGAGGAAATAGACTCTTATTCTTTCATGGCTGCAGTGTAAGCTCCAGGCCCTTTGGGTTTTATTTCAAACCTTGCTGTAATATAAAAAGGAAGTTTACAAGACATGACGTTGCTGCTTTTACAAAAGGACATTCTATTTATTTTTGCAGTAATTCTCATGTCCCCATAAGCAGAGCTGTCACAGTGTGCACTACCTTAAATTGTTTAGTTGTTATTTTTTTCCAGTTTGAGCTAATGTGTTTTATTTGTGAATAGTCTTTTACATTTTTGTATGCTGAATATGGGCACCAAAGAACCTGTAAAAGTTATCTTTTTCAATTGAATGTGCACAAATAAAAGTTTGGAAAAGGTCTCTCTTCATATCCA