Transcript asmbl_36915

Sequence
Transcript Sequence for observation asmbl_36915 of TGE0005303:
GGGTGACCTGGCCAAGAAGAAGATCTACCCCACCATCTGGTGGCTGTTCCGGGACGGCCTTCTGCCCGAAAACACCTTCATCGTGGGCTATGCCCGCTCACGTCTCACGGTGGCCAATATCCGCCAGCAGAGCGAGCCCTTCTTCAAAGCCACCCCTGAGGAGAAGCCCAAGCTGGAGCAGTTCTTTGCCCGCAACTCCTACGTGGCTGGCCAGTACGACGACGCAGCCTCCTATCAGCGTCTCAATAGCCACATGAACACCCTCAACCAGGGGTCAAAGGCCAACCGCCTCTTCTACCTGGCCTTGCCCCCCACTGTCTATGAGGCTGTCACCAAGAACATCCGAGAGAACTGCATGAGCCAGACAGGCTGGAACCGCATCATTGTGGAGAAGCCCTTTGGGAAGGACCTGCAGAGCTCCGACCAGCTGTCCAACCACATCTCCTCCCTGTTCAGCGAGGACCAGATCTACCGCATCGACCACTACCTGGGCAAGGAGATGGTCCAGAACCTCATGGTGCTGAGGTTTGCCAACAGGATCTTCAGCCCCATCTGGAACCGGGACAACGTTGCCTGCGTCATCCTCACCTTCAAGGAGCCCTTCGGTACTGAGGGCCGTGGGGGCTACTTCGATGAATTTGGGATCATCCGGGATGTAATGCAGAACCACCTCCTGCAGATGCTGTGTCTGGTGGCCATGGAGAAGCCCGCCTCCACTGACTCGGATGATGTCCGAGATGAGAAGGTCAAGGTGTTGAAATGTATCTCAGAGGCAAAGGCGAGCAACGTGGTCCTGGGCCAGTATGTGGGGAACCCCGACGGAGAGGGCGAAGCCACCAAAGGCTACTTGGACGACCCCACAGTGCCCCGTGGGTCCACCACCGCCACCTTTGCAGCTGTGGTCCTCTATGTGGAGAACAAGAGGTGGGACGGGGTGCCCTTTATCCTGCGTTGCGGCAAAGCCCTAAATGAGCGCAAGGCCGAGGTCCGCCTGCAGTTCCGAGACGTGGCTGGCGACATCTTCCAACAGCAGTGCAAGCGCAACGAGCTCGTGATCCGCGTGCAGCCCAACGAGGCTGTGTACACCAAGATGATGACCAAGAAGCCCGGCATGTTCTTCAACCCCGAAGAGTCGGAGCTGGACCTGACCTATGGCAACAGATACAAGAATGTGAAGCTCCCTGACGCGTACGAGCGCCTCATCCTGGACGTCTTCTGTGGGAACCAGATGCATTTTGTGCGCAGTGACGAGCTCCGGGAGGCCTGGCGGATCTTCACACCGCTGCTGCATGAAATCGAGGGCAAGAAGCTCCAGCCCATCCCCTATGTTTACGGCAGCCGAGGCCCGGCGGAGGCAGACGAGCTGATGAAAAGAGTGGGCTTCCAGTACGAGGGCACCTACAAGTGGGTGAACCCCCATAAGCTCTAAGCCCCGGGCGAGCCCACCCCGTCTGTCCGCCCTCCCCACCTTCCCAGCACCTGCCCCCACGTCGAGAAAACTTCGGGACCATAGACCTCAGCCTCGCATTCCTGGCCCCGGGCCCAGCAACATTCCTCTACCACTGAGCACTTGACACTCGTGCTGTGACCGTCCCCAGCCACCACTGGCCCTGTCCGAGCCAGCTTCTGTCCACAGGGCTGAGCCCCAATGGAAGGAAAGAGAAGAATGGCCCTTCTGTCTGTCCCAGGGTCCTTGGCCTAGGACAGGAGTTAAGGGCGAGGGGGAGGACCAGGGGTGGGCTTCAGCGGGCCAGTGGCCAACGCACACACCCAGGGGCTGTGGTCAAGCCCCTCAGAACCTGGGGAAAGGGAGCAAACGTGTCCACACCAGCCTCAGCACTACTGTACATTCCTGGTCACCCACTGAAGGGACTTCTGTGCCGCCAGCAATCCCCTATGTATTGGGCCCTCTGAACGTCCCTCTGCCCCGCCCGCTGCCCCCACCAGCCCAACTCTGCACTCCATGGCCCACCCAACCCACAGGTGCCCCCCTCGCTATTAGAAAAGCAGAAGCAGCAGGTGGGACACCCCACCTCAGCTCCCTGCCATTAAATATGTAAACAGA