Transcript asmbl_36893

Sequence
Transcript Sequence for observation asmbl_36893 of TGE0005298:
GAGCGGTGTCTGCCTGTCGGGACGTGCTGTGGTTCTCACTTTCCGTCATGGCGTTGAAGGTGGCGAAGGCCGTCGGCGGCTCTGCGAAGGCAGTGCTCAGGCCGGCACTCCTCTGCCGTTCTTGGGAGGTTCGAGGTGCCCACGACGCCCCCCAGAGGAGCTTCTCAGTAAGTACCTGCCTAGGTGTGTGTGCGTGACGATATGTGTGTGCTCGCACGTATGTATATTTGCGTTTGTGCATGTGTGCACCCGTCTGTGTGCATACATAGGTGTGTGTATGTACTGTGCGTGCACGCACAACATATGTACACATGTGTGCGTGTGCTCGTGTGTGTGCCGTGTCTTCTTGCTCCTTGGCCCTCCGTGTCCTTCCCTTTATGGCACATTCTCCAGAGGTCACCCACCCGTCCTCCTTACCTCCTTACCTGAACTGTGCTAGACAGCATCTCACGGAAAAGGCACAGCCTTGTTCCTCCAACCTTGGCTGATCCGAGTCTTCTTCCTTCCTGTTCTCACTCTAGCAACAAACAATTGTAAGTATCCTCCTCTGCCTGTTTAGATTTGGGGCTTTTCATTGCTTTGGGATCGACCCGAGTCTAGGCAGGGCAGGGACTGCTTCCGCTGCTGTCATCCTGGGCCCCCTGGGATGAAGTGGGGCACAGGGCTAAGGTACCCCAAGGTGGCACCTGATGACTGGCCAGCCCAGCAGGTCAGTGCTGGTGAGAGGAAGTGAACTAAAAGCCCGCCTTCTTCCTCCTTCCAGCCTCCATCTGCTAAGTATGGCGGGCGGCACACGGTGACCATGATCCCAGGGGACGGCATCGGGCCGGAGCTCATGCTGCACGTCAAGTCTGTCTTCAGGCATGCGTGTGTGCCAGTGGATTTTGAAGAGGTGCACGTGACCTCCAATGCTGACGAAGAGGACATCCGCAACGCCATCATGGCCATCCGTCGGAACCGCGTGGCCCTGAAGGGCAATATTGAAACAAACCATAACCTGCCGCCGTCTCATAAATCCCGCAACAACATCCTTCGCACTAGCCTGGACCTCTATGCCAACGTCATCCACTGTAAGAGCCTGCCGGGAGTAGTGACCCGGCACAGGGACATAGATATCCTCATTGTCCGGGAAAACACAGAGGGCGAGTATAGCAGCCTGGAGCATGAGAGTGTGGCAGGAGTGGTGGAGAGCCTGAAGATCATCACCAAGGCCAAGTCCCTGCGCATTGCCGAATACGCCTTCAAACTGGCCCAGGAGAGCGGGCGCAAGAAAGTGACAGCCGTGCACAAGGCCAACATCATGAAACTGGGCGATGGGCTCTTCCTCCAGTGCTGCAAGGAGGTGGCAGCCCGCTACCCCCAGATCACCTTTGAGAATATGATCGTGGACAACACCACCATGCAGCTGGTTTCCCGGCCCCAGCAGTTCGATGTCATGGTGATGCCCAATCTCTATGGCAACATCGTCAACAACGTCTGCGCAGGGCTGGTTGGGGGCCCTGGCCTCGTGGCTGGGGCCAACTATGGCCATGTGTACGCCGTGTTCGAGACGGCTACAAGGAACACAGGCAAGAGTATCGCCAATAAGAACATCGCCAACCCCACAGCTACGCTGCTGGCGAGTTGCATGATGCTTGACCACCTCAAGCTACACTCCTACGCCACGTCTATCCGCAGGGCCGTCTTGGCATCCATGGACAATGAAAACATGCACACCCCAGACATCGGGGGCCAGGGCACCACATCGGAAGCCATCCAGGACATCATCCGCCACATTCGCATCAGCAACGGCCGGGCCGTGGAGGCGTAGACTGCCCCCCTCCCCTCTCAGCACCCCAGCTGGCTTGTTGGGTGGACCCAGAATAAATCAGTTTCTGCCCCA