Transcript asmbl_36892

Sequence
Transcript Sequence for observation asmbl_36892 of TGE0005298:
GAGCGGTGTCTGCCTGTCGGGACGTGCTGTGGTTCTCACTTTCCGTCATGGCGTTGAAGGTGGCGAAGGCCGTCGGCGGCTCTGCGAAGGCAGTGCTCAGGCCGGCACTCCTCTGCCGTTCTTGGGAGGTTCGAGGTGCCCACGACGCCCCCCAGAGGAGCTTCTCAGTAAGTACCTGCCTAGGTGTGTGTGCGTGACGATATGTGTGTGCTCGCACGTATGTATATTTGCGTTTGTGCATGTGTGCACCCGTCTGTGTGCATACATAGGTGTGTGTATGTACTGTGCGTGCACGCACAACATATGTACACATGTGTGCGTGTGCTCGTGTGTGTGCCGTGTCTTCTTGCTCCTTGGCCCTCCGTGTCCTTCCCTTTATGGCACATTCTCCAGAGGTCACCCACCCGTCCTCCTTACCTCCTTACCTGAACTGTGCTAGACAGCATCTCACGGAAAAGGCACAGCCTTGTTCCTCCAACCTTGGCTGATCCGAGTCTTCTTCCTTCCTGTTCTCACTCTAGCAACAAACAATTCCTCCATCTGCTAAGTATGGCGGGCGGCACACGGTGACCATGATCCCAGGGGACGGCATCGGGCCGGAGCTCATGCTGCACGTCAAGTCTGTCTTCAGGCATGCGTGTGTGCCAGTGGATTTTGAAGAGGTGCACGTGACCTCCAATGCTGACGAAGAGGACATCCGCAACGCCATCATGGCCATCCGTCGGAACCGCGTGGCCCTGAAGGGCAATATTGAAACAAACCATAACCTGCCGCCGTCTCATAAATCCCGCAACAACATCCTTCGCACTAGCCTGGACCTCTATGCCAACGTCATCCACTGTAAGAGCCTGCCGGGAGTAGTGACCCGGCACAGGGACATAGATATCCTCATTGTCCGGGAAAACACAGAGGGCGAGTATAGCAGCCTGGAGCATGAGAGTGTGGCAGGAGTGGTGGAGAGCCTGAAGATCATCACCAAGGCCAAGTCCCTGCGCATTGCCGAATACGCCTTCAAACTGGCCCAGGAGAGCGGGCGCAAGAAAGTGACAGCCGTGCACAAGGCCAACATCATGAAACTGGGCGATGGGCTCTTCCTCCAGTGCTGCAAGGAGGTGGCAGCCCGCTACCCCCAGATCACCTTTGAGAATATGATCGTGGACAACACCACCATGCAGCTGGTTTCCCGGCCCCAGCAGTTCGATGTCATGGTGATGCCCAATCTCTATGGCAACATCGTCAACAACGTCTGCGCAGGGCTGGTTGGGGGCCCTGGCCTCGTGGCTGGGGCCAACTATGGCCATGTGTACGCCGTGTTCGAGACGGCTACAAGGAACACAGGCAAGAGTATCGCCAATAAGAACATCGCCAACCCCACAGCTACGCTGCTGGCGAGTTGCATGATGCTTGACCACCTCAAGCTACACTCCTACGCCACGTCTATCCGCAGGGCCGTCTTGGCATCCATGGACAATGAAAACATGCACACCCCAGACATCGGGGGCCAGGGCACCACATCGGAAGCCATCCAGGACATCATCCGCCACATTCGCATCAGCAACGGCCGGGCCGTGGAGGCGTAGACTGCCCCCCTCCCCTCTCAGCACCCCAGCTGGCTTGTTGGGTGGACCCAGAATAAATCAGTTTCTGCCCCA