Transcript asmbl_36548

Sequence
Transcript Sequence for observation asmbl_36548 of TGE0005287:
CTGACCCCAAAACCGTACACATCGTCCTCCCCTCCGGCCGTCTGTGCCCCCGTCTTCCTGGCCCTGGGCTGGCCCTTCTCCTCCTGTCTCTGGCCCTCCTTGTGTCTTGGTGCCACTGCCCCCACAGAAGAAGACAGGCATGATGGACACGGATGATTTCCGCGCCTGCCTTATCTCCATGGGTTACAACATGGGAGAGGCAGAATTTGCCCGCATCATGAGCATTGTGGACCCCAATCGCCTGGGGGTAGTGACATTCCAGGCCTTCATCGACTTTATGTCCCGTGAAACGGCCGACACGGATACAGCAGACCAAGTCATGGCTTCCTTCAAGATCCTGGCAGGGGACAAGAACTACATCACGGTGGACGAGCTGCGCCGGGAGCTGCCGCCGGACCAGGCCGAGTACTGCATCGCGCGAATGGCCCCCTACACCGGCCCTGACGCCGTGCCCGGTGCTCTGGACTACATGTCCTTCTCCACAGCGCTCTACGGCGAGAGTGACCTCTAACCCGCCCCCACTCGTCCAGCGCCCTCGCCCCTGCCCGCGTGAGCCCCGCCCTGCACCTCCGCTGTACCCCCTCTCCTGCCCGGGTTTGGTTTCCACGCCCAGCCTCCAACCGGCCAGCTGGGACCCGCCGCGGCGCTGATCCTCCCTGCCCGCCAAGTGACAGTTTACAAAATTATTTTCTGCAAAAAAGAAAAAAAATTATGTTAAAAAAAGTAAAAAAAACCAAAAAACCGCATATTTTATTATAGAAAAAGTATTTTTTTCTCCACCAGACTTAAATGGAAAAGAGGAAAAATTAACTATTTGCACCGAAATGTTTCGTTTTGTTGTGACATAGGAAAATAACTAAGCACAATGTTATATTTCATCCTTTTTATCGACTTTTTTTTCTATCTGTCCCATCTGCTGTATTCATTTCTCCAATCTCATGTCCGCCTTGATGTGGGAGTGGGGGGTGGGAGGTAGGGGATGATCTTGTCAAAAGGCACATTGGTGCATGTGTGTTTGCTAGCTCACTTGTCCATGAAAATATTTTATGATATTAAAGAAAATCTTTTGAAATGGATGTTTTTGCAAGGAAGAGGATTTATGTGGCTTGTCTCATTTTTAAGTTTAGAGGTGTGATTAGCCTCTTCATCCGTGCACTTTTTTTT