Transcript asmbl_358

Sequence
Transcript Sequence for observation asmbl_358 of TGE0005208:
AGGTAATTTTGTGTGTATTGGAGACCAGACCTGAAGCACTTCTGAATTTAAGATCCCCGATTCTTCGAGGCGGCATTGGACAGCGCTAAGATCAGAAGATGAGTGAACTTGACCAGTTACGGCAGGAGGCGGAGCAGCTTAAAAACCAAATCAGAGATGCTAGAAAAGCGTGTGCAGATGCAACTCTCTCTCAGATCACGAACAACATCGACCCAGTGGGAAGAATCCAGATGCGCACCAGGAGAACGCTGAGGGGGCACCTGGCCAAGATCTACGCCATGCACTGGGGCACGGACTCCAGGCTTCTCGTCAGTGCCTCCCAGGATGGCAAACTCATCATCTGGGACAGCTACACCACAAACAAGGTCCACGCCATCCCTCTGCGTTCCTCGTGGGTCATGACCTGTGCTTATGCCCCGTCTGGGAACTACGTGGCCTGCGGTGGCCTGGACAACATTTGCTCCATTTACAATCTGAAAACTCGAGAAGGGAATGTCCGCGTGAGTCGGGAGCTGGCCGGACACACAGGTTACCTGTCCTGCTGCCGCTTCCTGGACGACAATCAGATTGTCACCAGCTCTGGAGACACCACCTGTGCTCTGTGGGACATCGAGACCGGCCAGCAGACGACCACATTTACCGGGCATACCGGGGATGTTATGAGCCTCTCGCTCGCTCCTGACACCAGGCTGTTTGTCTCTGGTGCTTGCGATGCTTCAGCCAAACTCTGGGATGTGCGAGAAGGGGTGTGCCGGCAGACCTTCACCGGCCACGAGTCCGACATCAACGCCATCTGCTTCTTTCCAAATGGCAATGCGTTTGCCACTGGCTCGGATGATGCTACCTGCAGGCTGTTTGACCTCCGTGCGGACCAGGAGCTCATGACTTACTCCCATGACAACATCATCTGCGGGATCACCTCCGTCTCCTTCTCCAAGAGCGGGCGCCTCCTCCTCGCAGGGTACGACGACTTCAACTGCAACGTGTGGGACGCGCTCAAGGCCGACAGGGCAGGTGTCTTGGCTGGGCACGACAACCGCGTGAGCTGCCTGGGGGTGACTGATGACGGGATGGCTGTGGCCACGGGGTCCTGGGATAGCTTCCTCAAGATCTGGAACTAACGCCGACAGGTAACGAGCAGCCCAGGGGCCCTTCCCTGCAGGTGCCTCTGCGTCATTGTCCTAACACCTGAGGTGCGCGGTCGTGGTTTCCAGACCGAGTCTGAGGTAGAGCTGACGGGGAATCGTGGTAAGGTGAGCGTTTACCTCACCCCGAGCCGCGTGCCCTCGGCCGCACACCCAGGTGGAGCCGTAGAAGAACTGTAGCTGCGGTGACGGGCCTGAGCGTAGACACTGTTTCTTTTCACGTGTCTAACCTTTGTTTAAAACAGCAGGTGGACGC