Transcript asmbl_3521

Sequence
Transcript Sequence for observation asmbl_3521 of TGE0005329:
GGCGGCGGTGGCAGCGGCGGCGGTGGCAACGGCGGCAGCTGTGAAGGTGTTCCGGGAAGATGGTGCTGATCAAGGAATTTCGTGTGGTTTTGCCCTGTTCTGTTCAGGAGTATCAAGTTGGGCAGCTTTACTCTGTTGCAGAAGCTAGTAAGAATGAGACTGGTGGTGGAGAAGGAATTGAAGTCTTAAAGAATGAACCTTATGAGAAGGATGGAGAAAAGGGACAGTATACACACAAAATCTATCACCTAAAGAGCAAAGTTCCTGCATTCGTGAGGATGATTGCTCCCGAGGGCTCCTTGGTATTTCATGAGAAAGCCTGGAACGCATACCCCTACTGTAGAACAATTGTAACGAATGAATATATGAAAGATGATTTCTTCATTAAAATTGAAACATGGCACAAACCAGACTTGGGAACATTAGAAAATGTACATGGTTTAGATCCAAACACATGGAAAACTGTTGAAATTGTCCACATAGATATTGCAGATCGAAGTCAAGTTGAACCAACAGACTACAAAGCTGATGAAGACCCAGCATTATTCCAGTCAGCCAAGACCAAAAGAGGCCCTTTGGGACCCAACTGGAAGAAGGAGCTGGCAAACAACCCAGACTGTCCTCAGATGTGTGCCTATAAACTGGTGACCATCAAATTCAAGTGGTGGGGACTGCAAAGCAAAGTAGAGAACTTCATTCAAAAGCAAGAGAAAAGGATATTTACAAACTTTCATCGCCAACTTTTTTGTTGGATTGACAAGTGGATTGATCTGACAATGGAAGACATTAGGCGAATGGAAGATGAAACTCAGAAAGAACTAGAAACAATGCGTAAGAAGGGTTCCGTCCGAGGCACGTCGGCTGCTGATGTCTAGATGAGTCCCCTGTAGGGTCAGAGACAATATCAAACTGTTTACGTAATCAAGGTCAAGTAAGGGGAACAAGTGCAGCCAGTGATGAGTGAAGAAGAATCTGAACAGTATCTTGCAGTATTGGTGTTTCCCAGACGTGTGCTTGTGACTATCTAGTCACATGCACAGGTTCCCAGCCATGTGTGTATATATGTTTGTGTGTGTATATCCGTAGCTGTATATAAAATGCATGTAGAGCTACAGATCAGAATACACACACGTGTATATATATGTACATATAAACATACCGAAGGGATTAGTACAATTTCTCTTAAGTACTGTACCTATCTTCAGCAAGAATGCAAAAGAATATTTTCAATATGTATACCTGGAACAGATTTTAATAATCAGAGTAATATCATGAATGGACAAATTGACTGCAGTGTGATACTAGCTAGTATGTTTCATAAATGTCAAGTTGTGGACCAATATATACATATATAAATATATAGCCTTTTATTACTTTCCTTTTAAATCAGTCTCTTATAAATTTTTATTTCAGTCTCATAAGCAACAGACGCCCACAGAAAAATTATTCAAAATCTTTTTGCTATCAGCGAACGTAAACTCTGAATGTACATATAACGGTTTCTTTCTGGATGGTCATTATCTTACAGCCAAATTGGACAATATCTATTAGTAAGGAGTAAAGTTATAGGCCAGTTTTTACTTGTTTGCTTTGAGGGACAAAATCCTTTTAAAAAATTACTGGTTTTTATTGGATTTTTGTATTTAAATTTCAAGTATTTTTCTACATCAGACACAGCAAAAATGAGATGATGGTTTGTGATGTATAATAAACACGATACAATTTTTAGGCTCCTGTGAGTCAAACAAAGAAATTAATGAAGAAATTAATAGCATTGTAGGCTGTTTAGAAAAATTGGAAGTACAAGTGCTTCCACAGAGTCTTGTTTTTGAAATGACTGTTTTCTGAAATTACAGCTTGGAAACTATGCAAATGATTTAGATTCCTCACAGCTTACACGATAGACTATAGATAGTGATGATGTTTTGCTCTTTTCATGTTGAAACACACTTTAAGGGGGAGATGCTGACTTTGAATTAGGAAGAATTTAAGAGGCAGCTTGAGGCTCGCCTGCACACAGGAGGCCCTGCCCAGGAGCCGGTGCACCTCCACCCATTTGGCTGTGCTCTCAAGGAGGATGTCGTTGGAACATACCCTGAATAAGCATCGTGAAAACGCTGGTTAGAAGCTGCTGCTGCTGCCTTATTTTATTTTATTTTTTAAGAGAGGAACAATAGGTAAGATTTTTATCAGCTTTCTCTGTCCAAGTCCAGTTTTTCTCCTGTCAGTCCTGAAAGCTTGAATAGAATGATATTGTTGAAGCCTTCAGGTCACAAACTGTCGTCTTAACCTCTCGTCCCTCCTACAACACGCCAGCCCCTGTAGTCACATCACATTAGTAATCTGATTTGCTGACAGTCCTCCCCCCCCGCCCCCGCTTCTCTTTTCCCACATGTCCTGTGTCCCCAACAAAGTGATCGTAGTGACTGAGACAAGGATGTCTTCTGCATTACGATACCCTGTTATCCTCAGCCACAAACCCCACATTGCATATGTCCTCTGTGTACTCAGGATCAAGACTGATGTTTACTCTCTGGGCGCTATTGTAAGATAGGTTTTGTCAACACATAATCATTGTCTGCAAAGTGATGCAAGGAAGGAAGATTATTGCTAATTTTGTGAAATAAAGAGTCTAGCCCTCTCCTTTTAATGAACTTAACTCTCGCTGGCATCTGTAGCATCATTGGGAGCTTGGGCACACATGGAAATGAGAACCCAGCGCATGGATTTTAATGTTTTTCTAACAACTGTGGAGATTTGAGGGAATGTGTGGTGAATGTAAAATATCTAGTTTACTTGGCAGTCTCTTGTGTAAATTACAGTAAAATAAAGTAAATGAAATTTAAACAAAAAATAAATTTGATCACAAAAT