Transcript asmbl_34943

Sequence
Transcript Sequence for observation asmbl_34943 of TGE0005201:
GGCGCTTCCTGTTTCCGGTTCCCAGAGTGGAGCACCGCGAGGCGCTGAGGGGAACGCTGGCTGTGACACGAGCTCTGGGACTGGGGTCTGTGGCTGGCCCCTCGCTGGCCCTGTCTCCCAGCCCCAGACAGGTACTCACCTGGGGAGTCTGAGCTTTGGCTACTCCCTTTGCCCGTGACACGATGTTCCCCTTCTACAGCTGCTGGAGGACTAGATTACTGCTGCTGCTACTGCTGGCTGTGACGGTGAAAGAATCCTGGCAGGCAGAAGAGAAAACCTGTGACCTGGTAGGAGAAAAAGGTAGAGAGTCAGAGAAAGAGTTGGCTCTACTGAATAGGATGAAACCACTGTATAACAAAAGCTTTGAGAGCACTGTGGGCCAGGGCCCAGACAAGTATATGTACATATTCAGAGTGTGCCGAGAAGCTGGCAACCACACCTCTGGGGCAGGCCTGGTGCAGATCAATAAAAGTAATGGGAAGGAGACAGTGGTGGGGAGACTCAACGAGACTCACATCTTCAATGGAAGTAATTGGATCATGCTGATCTATAAAGGGGGTGATGAATATGACAATCACTGTGGCAGGGAGCAGCGCCGTGCAGTGGTGATGATCTCCTGCAATCGACACACCCTAGCGGACAATTTTAACCCTGTGTCTGAGGAGCGAGGCAAAATCCAAGATTGTTTATACCTCTTTGAGATGGATAGTAGCCTGGCCTGTTCTCCTGAGATCTCCCACCTCAGTGTGGGTTCTATCTTACTTGTCACGTTTGCATCTCTGGTTGCTGTCTATATCATCGGGGGGTTCCTATACCAGCGACTGGTGGTAGGAGCCAAAGGAATAGAGCAGTTTCCTCACTTAGCCTTCTGGCAGGATCTTGGCAACCTGGTAGCAGATGGTTGCGACTTCGTGTGCCGTTCTAAACCTCGAAATGTGCCTGCTGCATATCGTGGTGTGGGGGATGATCAGCTGGGGGAGGAATCAGAAGAAAGGGATGATCATTTATTACCAATGTGATTGCACTTTAAATGCCCAGCTTCTTCAGCCCCCCGCCCAGACCAAAGCATACTCAGCCAGATTTCTGAAGCAATCTCTCTACTCCAGTCTCTCCTCTCACCCTTAATGTTGCTCTTGCTTTCCAGTTTGCTTTTGGTTTGCATCCTCTTCTCACTAGTTGATATGCCTTCCCTTTTTCCTTATTTTTGGTTTTTCCTCAAGAGGTAGAGTTGTAGGTCAGAGGTTAACAGGGCCAGTGACAAGAGGCTATTGCACTGTCTTGGTACAGGAGGGTACAGTTAGGATCATTTTAATGAGCAAAAGCATGTGGCAGGCTTGCTGACCCTTTTTTAAACACATTTTCACAAGTTCTTGAGACACTGGATTTCTTTAA