Transcript asmbl_34756

Sequence
Transcript Sequence for observation asmbl_34756 of TGE0005158:
CTACTCGCGGTTTTACGGGCGCACGTAGCTCAGGCCTCCGCGCCCTTGGGCTGGGACTCCACAGGCTGGCGGGAGGCTGGTCGCGTCACCCACGCCCCCGCCGCGCCCCGTTTCTATAAATTGCGAGCGCAGCCTCCCCCAGCGCTCTCTGCTCCTCCCGTTCTACAGACAGCCGCGTCCTCCTGCGCAGTGCCAGCCGCGACCCTGAGACACGATGGTGAAGGTTGGAGTGAACGGATTTGGCCGTATTGGGCGCCTGGTCACCAGGGCTGCTTTTAACTCTGGCAAAGTGGATATTGTCGCCATCAATGACCCCTTCATTGACCTCAACTACATGGTCTACATGTTCCAGTATGATTCCACCCATGGCAAGTTCAAAGGCACAGTCAAGGCTGAGAATGGGAAGCTTGTCATCAATGGAAAGCCCATCACCATCTTCCAGGAGCGAGATCCCACCAACATCAAATGGGGTGATGCTGGTGCTGAATATGTTGTGGAGTCCACTGGTGTCTTCACTACCTTGGAGAAGGCTGGGGCTCACTTGAAGGGTGGAGCGAAGCGGGTCATCATTTCTGCTCCTTCTGCGGATGCCCCCATGTTTGTGATGGGTGTGAACCATGAGAAGTATGACAACTCCCTCAAGATTGTCAGTAATGCCTCCTGCACCACCAACTGCTTGGCCCCCCTGGCCAAGGTCATCCATGACAACTTTGGCATTGTGGAAGGACTCATGACCACAGTCCACGCCATCACTGCCACCCAGAAGACCGTGGACGGCCCCTCTGGGAAGCTGTGGCGTGATGGCCGAGGGGCTGCCCAGAACATCATCCCTGCTTCTACTGGCGCTGCCAAGGCTGTGGGCAAGGTCATCCCTGAGCTGAATGGGAAGCTTACTGGCATGGCCTTCCGTGTCCCTACCCCCAACGTGTCAGTTGTGGATCTGACCTGCCGCCTGGAGAAAGCCGCCAAATACGATGACATCAAGAAAGTGGTGAAGCAGGCGTCGGAGGGTCCCCTCAAGGGCATCCTGGGCTATACTGAAGACCAGGTTGTTTCCTGTGACTTTAACAGTGATACCCACTCTTCCACCTTCGATGCTGGGGCTGGCATTGCCCTCAATGACCACTTTGTCAAGCTCATTTCCTGGTATGACAATGAATTTGGCTACAGCAACAGGGTGGTGGATCTTATGGTCCACATGGCCTCCAAGGAGTAAGAGCCCCCTGGACCACCAACCCCAGTGAGAGGAAGAGGCCCTCAGCTCCTGGGGAGTCCTTGCCCCAAATCGATCCCCCAGCATACTGAGTGAGAATCTGACCTCCAGTTTCCATCCCAGACCCCCTGAAGAAGGGGAGGGGCTTAGGGAGCCCTACCTTGTCGTACACCATCAATAAAGTTCACTGTACCCAGCCAA