Transcript asmbl_33549

Sequence
Transcript Sequence for observation asmbl_33549 of TGE0005083:
TGGCCCCTACAGCGGTTAGTGGCGGCGGGAGCTGAGGAAGTAGGTGGGCCGGGTCGCGCCGCCTCCGGTGCCGGCCGTCCCTCCGTCTACCTTTCCGCCGCGGGCTCACCATGCCGCAGTATCAGACCTGGGAGGAGTTCAGTCGCGCGGCCGAGAAGCTCTACCTCGCCGACCCTATGAAGGCACGTGTGGTTCTCAAATATAGGCATTCTGATGGGAGTTTGTGTATTAAAGTAACAGATGATTTAGTTTGTTTGGTGTATAGAACAGACCAAGCTCAAGATGTAAAGAAGATTGAGAAATTCCACAGTCAACTAATGCGACTTATGGTAGCCAAGGAATCCCGCAGTGTTGCCATGGAAACAGACTGAATGGTTTGAAATGAAGACTGTTTGACATGTTCTTAGGAGTAAACATCTTTTGAATTTGAGGAAGTGTTGGGACAGAAAATACTTTATGTAACTAAGTGGGCTATTCAGAAGCCAAAAGATCATTTTTTTGTACATTGTTTTTTTAATGTTTCCTTTAGAGAGCTGGGAATAGAAATGATTTCGATTAGAAAGCCTTTATTTATTTTTGGAAATTGAACAAGAACTGCATCTATCTTGGGAACTTTTTGCGGATTATTTAATGCTGGGCAAAATATATAGCTATTTCTTTTGGTAAATTCGTATTGGTAATTTGAAAATGAGATGTCAAGAAAAGTCTATTCTTTAAATTTAGTTTATCCATCTTTAAAAGAAAATTAAACTCAACCATTTTACCGAATCGATAGACTTCTTTTGGAGCATAAAATTTGTATTGTTGATGACTAACAAATATAAACTATGGTAACTAGAATTAACTGCATAGCAGTATACCTAACAATATACAGTAGTATAGTCTAGATTGTATCTGAAAATAATTATGAAAACAAGTATGCTTTACCTTAAACTTTCAAAACTTAATCTATATTTTTGAGTATAAGAGTTTTATAATATTAATAGTTTGTTGAGCAGACTTACTTTGAATCTAGTTTTCAGTGCTCAAAACAACTGCAGTTCCTTTAAATGCATGAACAGAATATTCAGCGATGGACTGAAACCAGCATGTTACAGAAGTATTTGCCACACATTTCCCATCTGTAGTTTCTAAGAAGGGCTAAGGATTATGTAAATTGTTAAATTTTTGCAAAGCTCTTTGACACCCCTCCCCATTTCTCTACTTATCCAGCGGGTTAGCTTGACTGTCACACTTGTTATGTTTTCCATTAAACCAGAAGTATGATATTTAGTATTATCTATTTGTAACCTTAATTTTACCACCTAAATGTAATGTTCACTTGTCGATTCCTACATTAAAATATTTTTGGTATGGAACTTTCCATATTCCATTTTAATATGGAAAGTTCCATTAGCCATACAAATTTTGACATGTTTCAGAGAGGTCAATAAATAAAATATTATGTGGCTATATATTATTTCTCTCAAAGTTTTTAACTTCTCAAGAATCACTGATTTCTTAACTGGGATGTGCTGTATTCATGTCTAAAATGAGCTTAATGATACTGTAAATTTTGTTTTATTTTTTTGGTACTTTTATTACATGACTTTCTGTGAGCTGTATGTTAATGGCAAGGTTCTGTTCTTGGTTAAGAAAAGTAGCATCAAATAGTGTGGGACGTTTTGAGTTTCAGTTCTCTCCCCGCCCCCCCTTCCCAAAGTAGTGGAATCACTGGAGGGTTTTTTTGGCCTTTTTCTTTTCTCATTTACGTCTTCCACTTTTTAATGCTGCTTTATAAAGATAACCAGAGAGGGCTGGGCTAATTCTGGCTCGAGTCCTCAGTAGCTTGTGGGAGAGTGGTTAGAGCAGAGGTTCCAAGGCGGGCCGCCTGTGCTGCAGTCTCGGCTCCACTGCTTCCTATCACTGTGGTCTTGGAAAAGGCACTTCTGTAAGGCTCCGTGTTCCTCTGGAGATTGAGTTAACAGTAGTACTCATAGGACTTCATGAAGATTAAAGGGCATAATCCATTTTAAGCCTTTAGCACAGTGCCTGGAACATAGTAAAACTATTATTTCGGCCAACTATTGTTATTATTAGTCTTAATAGACTATAAACTCCCTTAAGTTTTCTTTTAATTTTAATTGAATAATTATTTATTGGTAATGTCTGCCTTTTCTGCCAGTCTGTGTCTATTATTAAATGCCGTTTTTGGCAGTTGAGAAATACAACAAGATTGCCCTCAGAGTGATCTTATTCGGGGGCAAATCCTTAAATCTAAAACTTGTGTTCATTCATAGCTGTATAAAGTAAAATCATTGAACTAATTGGTGGTAAAAGTATTGAATCTCTTAAAAACCATATAAATAATAAAACATCACATTCTGAAAATCGCA