Transcript asmbl_33300

Sequence
Transcript Sequence for observation asmbl_33300 of TGE0005060:
TCTTCCGGGTGATGGCGGCCCGGTGCCCCGGATGTAGGCTTGGCGAAAGCATCGCTTCTTCCCCCGCCTGCCTTGGACTCGTAGCTTGGTGAAGGCCCCTCTGTCCAGTTATGTCAAAGAGGAAAGTGACCTTCCAAGGCTTGGGAAATGAGGATGATGAAGACGAAATCAGTGTCCCCAAGAAGAAGCTGGTGGACTCTGTGGCTGGGGCAGGAGGTCCTGGGAGCCGCTTTAAAGGCAAGCACTCTTTGGACAGCGATGAGGAGGATGATGATGATGAGGGGTCCAGCAAATATGACATCCTGGCCTCAGAGGATGTAGAAGGTCAGGAAGCAGCCACACTCCCCAGCGAGGGAGGGGTACGGATCACACCCTTCAACCTACAGGAAGAGATGGAGGAAGGCCACTTTGATGCTGATGGCAACTACTTCTTGAACCGGGAGGCTCAGATACGAGACAGCTGGCTAGACAACATTGACTGGGTTAAGATCAGGGAGCGGCCACCTGATCAGCACCCACCATCAGACTCAGAGGAGGAGGACAGCCTGGGCCAGACACCAATGAGTGCCCAAGCCCTCCTGGAGGGCCTTCTGGAGCTGCTGTTGCCGAGAGAGACAGTGGCTGGGGCGCTGAGGCGCCTAGGGGCCAGAGGAGGAGGCAAAGATGGCAGCAAGGGGCCTAGGCGGCCTAGTTCCCCCCAGCGCTTGGACCGGCTCTCCGGGTTGGCTGACCAAATGGTGGCCCGGGGCAACCTTGGTGTATATCAGGAGACAAGGGAACGGTTGGCCATGCGGCTGAAGGGGTTGGGGTGCCGGACCCAGGGACACCCTGACCCCAAGCCCCCACCTTCTCTGGACATGTTTGCTGAGGAAGTGGCAGAGGGGGAGCTGGAGACCCCAACCCCTGCCCAGAGAGAAGCAGATTCGCCAGGAGATGGTTTGCTGGATGTGATGTGGGAGTATAAGTGGGAGAACACAGGGGATGCTGAGCTGTACGGGCCCTTTACCAGCACCCAGATGCAGACCTGGGTGAATGAAGGCTACTTCCCGGATGGTGTTTATTGTCGGAAGCTGGACCCCCCTGGTGGACAGTTCTACAACTCCAAACGTATTGACTTTGACCTCTACACCTGAGCCTACTGAGGGCTCACTTAGGTGGCCCCTTCTTTCCTGGACTCTGTGAAGGAGGCTCCAGCTGCCTCAGGCAGTGAGGATATTGGGGGCAACTTTTCAGTCAATTTTCCTTTCCCAATAAAAGCCTTTAGTTGTGTGTTAGGGCCTTGGCTTTGCTGATGGCCAGAAGCCAGAGACCACAGCCCCTTTGGACTTGCCTTGGTCTTATAGTGTTTCCTCATGAAGTTCCTCTTTGACAGTTCTGGTCCCTCAAACCATCTCCTGTTTACTGTTCATAAGGGCAGAGCCAGGGCTGTCAGGTGAACAGTGGCCTCCCTTTTTGGATGCAGATCACCATCTAAAAATCTCTTTACTCGTGTGGCATTCTTTGGTATCCTCTGGGCTTCCTGTTTTGCTTTTCTTCGGTCTTTGGTCTTTAGGACCTCAGAGTCTCTCCTTGCAAACAGTGCAGGGTAGAGCCCTAGCAGCGGAGATTTTAGGTCTGATGGGCTGGGGCATCTGTTGGTTTTGAGTAGGAAGCATGGTACTCACTGGCTTCTCATTTTCTCAGGCTCCTTAGGTGAAGTACAGACTCAGTATTGACTCTTGAAGGACTCCAAGGCCACCTGGGCAAACCATCCATAGAATAGGCACAGAGAGGGACAGCACCTCACTGAAGGTTACACAGTTAATCAGAGGACTGGCCCAGACCCAATGGGCTCCCTTCCCAGACCTTTCTTGGTACTAGGTCTTTTCTACCTGGCCTTGAAGCCCTGAGCTTACATTTCCTGAGCTTCCAAAGTGTGCCTGGCACTGAACTAGTGCCTTGAGGAAACTGAGATAACTGGGCTGGTCCCCTTTCAGGAGTTCACAGTCAGGAGTGTAGGTGAAGAGGGAGATAGACAAGTATAATTGTACAGTCTGGACCTACCACTACCACCCTCCCAGCCCATCAGTATGGCTTAAAGCCTCTCCTCACTTGACCAGTTTAGATTTTTCCCTCCACTTTTTCAACTTGGCTGTCCATTGGAATCTCATAGAGAGCTGTTAAATCACTCCTCAGAGACTCCGAATGAGTTGGTTTAGGTAGTGGCCTGGCAGTTGGGTTTTTAAAAAGTTCTCAGGTCTTTCTAATGTGTGGCCAGGTGGAGAGCCATTGGATCTGACTCCCATGACAAGTTATACCTGGGGAGAGGGGCTGGTTCCTGGACTCCGCCGTGGTAGAGCTGAGCATGTGTCTGGCCAGGGCTCTGGTTGATTCTGTTAGTTACAGGAGAGCTGAGCACCAGAGCCGTGGATGCATGGGAGCTCCAGGGTGGAAGGAACCAGGACTGGAACTAGGAAAGACTTG