Transcript asmbl_14062

Sequence
Transcript Sequence for observation asmbl_14062 of TGE0000242:
GGCTGACGGCAGGGGAGGAGCCGGGTCCACTGCCGGGTGGAGGGGCAAGGCGAGTGTGTGTCCTTATCCTAGCAATTGGGGCGCGGGCCTGTGAGCCAGTTGGAGTTGCGGCGGCGGGAACGATTGGGCTGAGCAGAGGACGACATGTTGCTTTTCGTGGAGCATTTATGGGGTTAAGTGGCATGGGATTTCTGTTTCTGATAGTAAATAGCAGGTAGCATCTAAAGGAACTGGTTTAAATCCTAATGCCAAAGTATGGCAAGAAATTGCTCCTGGAAATACTGATGCCACCCCAGTAACTCATGGAACTGAAAGCTCTTGGCATGAAATAGCAGCTACATCAGGTGCTCATCCTGAGGGTAATGCAGAGCTCTCAGAAGATATATGTAAAGAATATGAAGTAATGTATTCTTCATCTTGTGAAACCACAAGAAATACTACAGGCATTGAAGAATCAACTGATGGGATGATTTTAGGACCAGAAGATCTGAGTTACCAAATATATGATGTTTCCGGAGAAAGCAATTCAGCAGTTTCTACAGAAGACCTAAAAGAATGTCTGAAGAAACAATTAGAATTCTGTTTTTCACGAGAAAATTTGTCAAAGGATCTTTACTTGATATCTCAAATGGATAGTGATCAGTTCATCCCAATTTGGACAGTTGCCAACATGGAAGAAATAAAAAAGTTGACTACAGACCCTGATCTAATTCTTGAAGTGTTAAGATCTTCTCCCATGGTACAAGTTGATGAGAAGGGTGAGAAAGTGAGACCAAGTCATAAGCGTTGTATTGTAATTCTTAGAGAGATTCCTGAAACAACACCAATAGAGGAAGTGAAAGGTTTGTTCAAAAGTGAAAACTGCCCCAAAGTGATAAGCTGTGAGTTTGCACACAATAGCAACTGGTATATCACTTTCCAGTCAGACACAGATGCACAACAGGCTTTTAAATACTTAAGAGAAGAAGTTAAAACATTTCAGGGCAAGCCAATTATGGCAAGGATAAAAGCCATCAATACATTTTTTGCTAAGAATGGTTATCGATTAATGGATTCTAGTATCTATAGTCACCCCATTCAAACTCAAGCACAGTATGCCTCCCCAGTCTTTATGCAGCCTGTATATAATCCTCACCAACAGTACTCGGTCTATAGTATTGTGCCTCAGTCTTGGTCTCCAAATCCTACACCTTACTTTGAAACACCACTGGCTCCCTTTCCCAATGGTAGTTTTGTGAATGGCTTTAATTCGCCAGGATCTTATAAAACAAATGCTGCTGCTATGAATATGGGTCGACCATTCCAAAAAAATCGTGTGAAGCCTCAGTTTAGGTCATCTGGTGGTTCAGAACACTCAACAGAGGGCTCTGTATCCTTGGGGGATGGACAGTTGAACAGATATAGTTCAAGAAACTTTCCAGCTGAACGGCATAACCCCACAGTAACTGGGCATCAGGAGCAAACTTACCTTCAGAAGGAGACTTCCACTTTGCAGGTGGAACAGAATGGGGACTATGGTAGGGGCAGGAGAACTCTCTTCAGAGGTCGAAGACGACGAGAAGATGACAGGATCTCAAGACCTCATCCTTCAACAGCTGAATCAAAGGCTCCAACACCAAAGTTTGACTTATTAGCCTCAAATTTTCCACCTTTACCTGGAAGTTCATCAAGAATGCCAGGTGAACTCGTTTTGGAGAATAGGATGTCTGATGTTGTTAAAGGTGTCTACAAAGAAAAGGATAATGAAGAGTTGACAATTAGTTGCCCAGTGCCTGCAGATGAGCAGACAGAATGCACTTCTGCCCAGCAACTCAATATGAGTACCAGTTCTCCATGTGCTGCTGAGCTTACTGCATTAAGCACAACTCAGCAAGAAAAGGATCTAATAGAAGATTCCTCTGTTCAGAAGGATGGTCTCAATCAGACAACTATACCAGTTTCTCCTCCAAGTACTACAAAGCCATCGAGGGCAAGTACTGCTTCACCATGTAATAATAACATAAATGCAGCTACAGCTGTGGCTCTACAGGAACCCCGAAAGTTAAGTTATGCTGAAGTGTGCCAGAAGCCCCCTAAAGAGCCATCTTCAGTTCTTGTGCAGCCACTACGGGAACTTCGCTCCAATGTGGTGTCTCCCACCAAAAATGAAGACAATGGAGCTCCTGAGAACTCCGTTGAGAAACCACATGAGAAGCCAGAAGCAAGGGCTAGTAAGGATTATTCTGGCTTCCGAGGCAATATAATCCCCAGGGGAGCAGCAGGAAAAATCAGGGAACAGAGACGCCAGTTTAGCCATAGGGCTATACCTCAGGGAGTGACTCGACGTAATGGCAAAGAGCAATATGTGCCACCCAGATCACCAAAGTAAAAAACAACAAAACTATTCAAAAACTTCACTCTCTTCCCATTAAACTTGAACTGTGGCTATATTGAACTGTTTTGGAGGGGAGGGGGTAGCCAGGAAGGAAACAAGAGAAAGTACGTCCATTTCATTATGGATTTTGGAGTTGTGAGTGATAGGATCCCAAAATTCATCTCTAATGTGGTTTTTAAATGCTGGAGGATTCCAATCAATATAAATATATATATATATATACACACACATATATAAAA