Transcript asmbl_32345

Sequence
Transcript Sequence for observation asmbl_32345 of TGE0018818:
CCGGAAGTGTCTTCCAGTTGCCATTGATCGTTCCTTAGTGCACGCGCGGGCACCCGGTACTCGGTACCCGGCCCTCGGGGCGTGAGTCCGACCACGATGGCGGCTACCACCTTGCTGCGCACGACGCCCCTCTTCGGCGGGCTGGGCGCCGGTCCGACCTCACTACTGCAGGGTCTGTTGCGGCCGCCGAAGGCTCCGGCATTGTCTCTCTTGTGCCGCGGCCTGGCGGTGGAGGCTAAGAAGATCTATGTGCGCGACAAGCCCCATGTGAACGTGGGTACCATTGGCCATGTGGACCACGGCAAGACCACACTGACCGCGGCCATCACGAAAATTTTAGCTGAGGGAGGTGGGGCCAAGTATAAGAAGTACGAGGAAATTGACAATGCTCCAGAGGAGCGAGCCCGTGGTATCACCATCAATGCAGCCCATGTGGAGTATAGCACTGCCGCCCGCCACTATGCCCACACAGACTGCCCGGGTCACGCAGATTATGTTAAGAATATGATCACAGGCACTGCCCCTCTTGATGGCTGCATCTTGGTGGTGGCAGCCAATGACGGCCCCATGCCCCAGACCAGAGAGCACTTATTACTGGCCAAACAGATTGGAGTAGAGCATGTGGTGGTATACGTGAACAAGGCAGATGCCGTCCAGGACTCTGAAATGGTGGAGCTAGTGGAGCTGGAAATCCGAGAACTGCTCACTGAATTTGGCTACAAAGGGGAAGAGACTCCAGTCATCATAGGCTCTGCCCTCTGTGCCCTTGAGGTGAAGGCAGGGTCAGGCAGGGGCTGCTGTGGCAAAGGATGGGGCTGGATGGGCATCTAGAGCTCTGCTTTGAGTCTGGGGAGTGGTTCTTCATAAGCAGAATGAAAATTTC