Transcript asmbl_31109

Sequence
Transcript Sequence for observation asmbl_31109 of TGE0004922:
GGAGGTGGAGGAGGAGGAGGATGGGAAGAAAGGTTCCTTGGAGACCCTGGAGGAGCTGGTCCAAGGACTAGCCTCTGAGGTGTGTGATGATTTTCTTTTCTACTGTGGAGACACACATAGCAGCTTCGTGGTCAGAACTCTGCTGCAGGTGTTAGGAGGGACTCTTCTGGAGTCTGAGAGAGCCAGACACCGTGGCTCCCAGTCACCTGAAACACAAAGGGCCCCACCTCGAGAATGTAAACCAACTGATTTTGAGGTTCCTGAATCCTTCTTGAATTGCCTTCAGGACCTGAGCTCCTGCTTTCTGAAGGATATTGCTGTGTTTATCACTGACAAGATCTCCAGCTTCTGCCTTCAAGTGGCCTTACAGATCTTACACCGCAAACTTCCCCAGTTTTGTGCCCACCTCTGTAATGCTGTGATTTGCTACCTGAGTAACCGCAATTCCTCAGCAGATGGCAGCCCCCTACTGCTATTTCTGCGGGATCAGACGAGCTCCAGACTCCTGGAGCAGGTGCTGCTGGTGTTGGAGCCTCCGAAGCTCTGGAGCCTCTTTGAGGATCACTTCCAAGGGCAGCTGCAGATCCTCGCTGCACATCCTATTGCCAACTTCCCTTTGCAGCGTTTACTGGATGCTATCACTACACCTGAGCTACTGTCCTCCGTGTTTGAGGAGCTGAGCCCTGCCTTGGAAGCTGTGCTGGCCCAGGGTCACCCAGGGGTAGTTGTTGCCCTGGTGGGGGCCTGCCGCAGAGTTGGAACCCACCAAGTCCAGGTCCTGCAGCTGTTGTTAGAGGCATTCCACTGTGCAGAGCCCTCTTCCCGGCAAGTGGCCTGCGTGCCTCTCTTTGCCACTTTGATGGCTTACGAGGTGTACTATGGACTAGTAGAGGAGGAGGGGACAGTGCCTGCAGAGCACCAGGTTGAAATGGCCACAGCCAGGGCCCTAGGGGAAGTGTCAGTCCTTGGGTCTCTACTGCTCCAGCATCTATTACATTTCTCTGCTCCTGGCCTTATACTTCGAAGTCTGGGTGCCTTGACAGGACCACAACTTCTGACTCTGGCCCAAAGCCCTTCTGGTTCCCATGTGCTTGATGCCATCCTGACCAGTCCCTCCGTGACGCACAAGCAGCGCCGCCGTGTGCTGAAGACCCTAAAGGGACAATATGTGGCTCTGGCTTGCAGTCGCCATGGCAGCCGTGTGCTAGATGTCATCTGGGGTGGAGCAGCCTTGGGGGCCCGGAAGGAAATTGCTGCTGAGCTGGGGGAGCGGAACCAGGAGCTGATAAAAGATCCTTTTGGCCACCACGTGGCTCGAAATGTGGCCCTGACTACCTTCTTGAAGCGACGAGAAGCTTGGGAACAGCAGCAGGGGGCGGTGGCCAAGCGGAGGCGGATTTTGAACTCAATACTTGAGGACTGAGGCCTTGGGATCCGGGACTGGGTGTTGATGGGGGAGGGGGAAAGGGAGTATCTATTTTATCCCCTTCCTGGTTTAAATTGGA