Transcript asmbl_30737

Sequence
Transcript Sequence for observation asmbl_30737 of TGE0004896:
CCGGCCACTTCCGGCCACCTCAGGCCTTTTCCGCTTGTTCTCTGCTGGTTTTAATCTCTCCTTCTCAGGTTGTTTCCGACTGTAGGCCCGGGTCATCTAGCACCCCTTTCCTGCTACCAGCAGTTCGCTGCTCATCCGGTTTCTGTCCGAGGTTTGGAGCAACTCTGCCGTGCAAATTCGCGGAGCGGTCGGGGCTGAGGCCTTCCGCGCACAGTGAGTCCGCGCAGACCTGACCCCGCGTCTACCTACAGCTCCGTGGAGGCCACCGCCGCCTCCGCCTAGGGATGCCGCGGCTGGGGTCCGCGCAGCGCTGGGCGGCCGCTGTGGGCCGTTGGGGCTGCAGGCTGCTCGCGCTGCTGCTGCTGGTGCCGGGACCCAGCAGCGCCTCTGAGATCACTTTCGAGCTGCCTGACAATGCCAAGCAGTGTTTCTACGAGGACATCACGCAAGGCACCAAGTGCACCCTCGAGTTCCAGGTGATTACTGGAGGTCACTATGATGTAGATTGTCGATTAGAAGATCCTGATGGTAATGTGTTATACAAAGAGATGAAGAAACAATATGATAGTTTTACCTTCACAGCTTCTAGAAATGGGACATACAAATTTTGCTTCAGCAATGAATTTTCCACTTTCACACATAAAACCGTATACTTTGATTTTCAAGTTGGAGAAGACCCACCTTTGTTTCCTAGTGAGAACCGAGTCAGTGCTCTTACCCAGATGGAATCTGCCTGTGTTTCAATTCACGAAGCTCTGAAGTCTGTCATCGACTATCAGACTCATTTCCGTTTGAGAGAAGCTCAAGGCCGAAGCCGCGCAGAGGATCTAAACACAAGAGTGGCCTATTGGTCAGTAGGAGAAGCCCTCATCCTTCTGGTGGTTAGCATAGGGCAGGTATTTCTTCTGAAAAGCTTTTTCTCAGATAAAAGAACCACCACAACTCGTGTTGGATCATAACTACGTTTTGAGAATTGATGCACCATTGCAACTATAATATTGCTGTCTTCTAATTAATTAATTTTAGGTACTGAAGAACTTGATATTGGCAACATTTTCAAAACCTTATTCATATACTTGTTAGGGGGTTATGTACAATGCATAAACCCAAACAGTGGAAAGGACACCTTTTTTTATTTGTAAAGGTATAAAAACTTTGGAACTTATTTTGGGCTATTCATGTTAAATATTCAACACCAATGATCTGCTCTTTGTTGTTTATATCTACTCTTTGCACACTAAACTTTGGTATTTTGATTTAGCCATTTAAAAGTACTTTTCTTATAGGTAGTGGATACTTTAAAAACCTTTGATTTAATGTCTACATGTGTTGTGGAGGAAGAAAATTGCCTTTTGATTGTTTATAGTAAATAAGGATTTGTTTTTCAGAAATGCATATGTGATTAACTGCAGTCCACGCCCTATTCTGCACTGTTTAATTTTTATGGGGGAAGAATCTACAATAGAAATGTTTGTTGATATTGATATAATTTTAAATCGATACATCATGGTATAATTTATTTATCACTAGCTTGGAAAATGTCAGATTTTGGCAGGGAGGCAGTTTATTCTATGATTTATAACCAGATATGTTCTTTTTTTCTTAAAGACATTCTTCCACACAAAATAGTGTGTTTCAGTAACATCATAGGGTTTATATGGGCCTTAAAAATCAGATTGTCATGATAAAATAATTAAGAATAATTAAAGTCACTACAATGTCTTATAGTGGAGGGGCAAATGAGAAAATTTTTAGTGAGTTATCTGCACACACTACATTTTCAGTGCTTTTACAAAGAAAAAAGGTGATCTGTTTCATTTTAACATTTTATTGGCTGGTTCTTGCCCTTATGTGGCTTTAATGTCTGAGTCATTCCCAACTTAAAATGACAGTTGTAATATTAGTATCGTAAAAGTGCCATACATTTTATCCTGATTGGTGTGATACACTGAAAAATTAGTTTTTCCCTCCTTCCTTCCCTCCTTCCTTCCTTCTTTCTTTCTGTCTTTCTTTCT