Transcript asmbl_14035

Sequence
Transcript Sequence for observation asmbl_14035 of TGE0000240:
AAGCCTCTCCTCCTTCCCCCTCCCTCTTTGCCTCCACCTGGCTCCTCCCCATGTTCGTCCATCACCCCTCCCCCCTTTCCCAAGGACAATCTGCAAGAAAGCAGCGGCGGAGGAGAGCTAAGACTAAAAGAGTGGATCATGACCCATGAAGAGCACCATGCAGCCAAAACCCTGGGGATTGGCAAAGCCATTGCTGTCTTAACCTCTGGTGGAGATGCCCAAGGTATGAATGCTGCTGTCAGGGCTGTGGTTCGAGTTGGTATCTTCACCGGTGCCCGTGTCTTCTTTGTCCATGAGGGTTATCAAGGCCTGGTGGATGGTGGAGATCACATCAAGGAAGCCACCTGGGAGAGCGTTTCGATGATGCTTCAGCTGGGAGGCACGGTGATTGGAAGTGCCCGGTGCAAGGACTTTCGGGAACGAGAAGGACGACTCCGAGCTGCCTACAACCTGGTGAAGCGTGGGATCACCAATCTCTGTGTCATTGGGGGTGATGGCAGCCTCACTGGGGCTGACACCTTCCGTTCTGAGTGGAGTGACTTGTTGAGTGACCTCCAGAAAGCAGGTAAGATCACAGATGAGGAGGCTACGAAGTCCAGCTACCTGAACATTGTGGGCCTGGTTGGGTCAATTGACAATGACTTCTGTGGCACCGATATGACCATTGGCACTGACTCTGCCCTGCATCGGATCATGGAAATTGTAGATGCCATCACTACCACTGCCCAGAGCCACCAGAGGACATTTGTGTTAGAAGTAATGGGCCGCCACTGTGGATACCTGGCCCTTGTCACCTCTCTGTCCTGTGGGGCCGACTGGGTTTTTATTCCTGAATGTCCACCAGATGACGACTGGGAGGAACACCTTTGTCGCCGACTCAGCGAGACAAGGACCCGTGGTTCTCGTCTCAACATCATCATTGTGGCTGAGGGTGCAATTGACAAGAATGGAAAACCAATCACCTCAGAAGACATCAAGAATCTGGTGGTTAAGCGTCTGGGATATGACACCCGGGTTACTGTCTTGGGGCATGTGCAGAGGGGTGGGACGCCATCAGCCTTTGACAGAATTCTGGGCAGCAGGATGGGTGTGGAAGCAGTGATGGCACTTTTGGAGGGGACCCCAGATACCCCAGCCTGTGTAGTGAGCCTCTCTGGTAACCAGGCTGTGCGCCTGCCCCTCATGGAATGTGTCCAGGTGACCAAAGATGTGACCAAGGCCATGGATGAGAAGAAATTTGACGAAGCCCTGAAGCTGAGAGGCCGGAGCTTCATGAACAACTGGGAGGTGTACAAGCTTCTAGCTCATGTCAGACCCCCGGTATCTAAGAGTGGTTCGCACACAGTGGCTGTGATGAACGTGGGGGCTCCGGCTGCAGGCATGAATGCTGCTGTTCGCTCCACTGTGAGGATTGGCCTTATCCAGGGCAACCGAGTGCTCGTTGTCCATGATGGTTTCGAGGGCCTGGCCAAGGGGCAGATAGAGGAAGCTGGCTGGAGCTATGTTGGGGGCTGGACTGGCCAAGGTGGCTCTAAACTTGGGACTAAAAGGACTCTACCCAAGAAGAGCTTTGAACAGATCAGTGCCAATATAACTAAGTTTAACATTCAGGGCCTTGTCATCATTGGGGGCTTTGAGGCTTACACAGGGGGCCTGGAACTGATGGAGGGCAGGAAGCAGTTTGATGAGCTCTGCATCCCATTTGTGGTCATTCCTGCTACAGTCTCCAACAATGTCCCTGGCTCAGACTTCAGCGTTGGGGCTGACACAGCACTCAATACTATCTGCACAACCTGTGACCGCATCAAGCAGTCAGCAGCTGGCACCAAGCGTCGGGTGTTTATCATTGAGACTATGGGTGGCTACTGTGGCTACCTGGCTACCATGGCTGGACTGGCAGCTGGGGCCGATGCTGCCTACATTTTTGAGGAGCCCTTCACCATTCGAGACCTGCAGGCAAATGTTGAACATCTGGTGCAAAAGATGAAAACAACTGTGAAAAGGGGCTTGGTGTTAAGGAATGAAAAGTGCAATGAGAACTATACCACTGACTTCATTTTCAACCTGTACTCTGAGGAGGGGAAGGGCATCTTCGACAGCAGGAAGAATGTGCTTGGTCACATGCAGCAGGGTGGGAGCCCAACCCCATTTGATAGGAATTTTGCCACTAAGATGGGCGCCAAGGCTATGAACTGGATGTCTGGGAAAATCAAAGAGAGTTACCGTAATGGGCGGATCTTTGCCAATACTCCAGATTCGGGCTGTGTTCTGGGGATGCGTAAGAGGGCTCTGGTCTTCCAACCAGTGGCTGAGCTGAAGGACCAGACAGATTTTGAGCATCGAATCCCCAAGGAACAGTGGTGGCTGAAACTGAGGCCCATCCTCAAAATCCTAGCCAAGTACGAGATTGACTTGGACACTTCAGACCATGCCCACCTGGAGCACATCACCCGGAAGCGGTCCGGGGAAGCTGCCGTCTAAACCTCTCTGGAGTGAGGGGAATAGATTACCTGATCATGGTCAGCTCACACCCTAATAAGTCCACATCTTCTCAGTGTTTTAGCTGTTTTTTTCATTAGGTTTCCTTTTATTCTGTACCTTGCAGCCATGACCAGTTCTGGCCAGGAGCTGGAGGAGCAGGCAGTGGGTGGGAGCTCCTTTTAGGTAGAATTTAACATGACTTCTGCCCCAGCTTTATCTGTCACACAAGGCTGGGCACCTCTAGTGCTACTGCTAGATATCACTTACTCAGTTAGAATTTTCCTAAAAATAAGCTTTATTTATTTCTTTGTGATAACAAAGAGTCTTGGTTCCTCTACTACTTTTACTACAGTGACAAATTGTAACTACACTAATAAATGCCAACTGGTCACTGTGCTTTTGCTTCTCCTGTTATCATCTTCCTAA