Transcript asmbl_10768

Sequence
Transcript Sequence for observation asmbl_10768 of TGE0000024:
GTCCGAGGCCGATCTGATTGTTGTGTGTGTGTGTTAGGCGGCCGGGGCGCTGTGGAGAATGAGGAGGACCTGCCAGAACTGTCGGACAGCGGGGACGAGGCCGCCTGGGAGGATGAGGACGATGCAGATCTCCCCCACGGCAAGCAGCAGACCCCCTGCCTGTTCTGTAACAGGTTATTCACATCTGCTGAAGAAACATTTTCACACTGTAAGTCTGAGCATCAGTTTAATATTGACAGCATGGTTCATAAACATGGACTTGAATTTTATGGATACATTAAGCTAATAAATTTTATTAGACTTAAGAATCCTACAGTTGAGTACATGAATTCCATATACAACCCAGTGCCTTGGGAGAAAGAAGAGTATTTGAAGCCAGTATTAGAAGATGACCTTTTACTTCAATTTGATGTAGAAGATCTTTATGAACCGGTGTCAGTACCCTTCTCATACCCCAATGGACTCAGTGAAAATACATCTGTTGTTGAAAAATTGAAACATATGGAAGCCAGGGCACTGTCTGCTGAAGCCGCATTGGCCAGAGCACGTGAGGATCTGCAAAAAATGAAACAATTTGCTCAGGATTTTGTGATGCACACAGATGTCAGAACCTGCTCGTCATCTACTAGTGTCATTGCGGACCTCCAGGAGGATGAGGATGGTGTTTATTTCAGCTCATACGGGCATTATGGGATACATGAAGAAATGCTAAAGGACAAAATACGAACAGAAAGCTACCGAGATTTCATATACCAAAATCCACATATCTTCAAAGACAAGGTAGTTTTGGATGTTGGGTGTGGAACTGGAATTCTCTCTATGTTTGCTGCTAAAGCTGGGGCGAAGAAGGTTCTTGGAGTTGATCAATCTGAAATACTTTACCAGGCAATGGATATTATAAGACTAAATAAACTTGAAGATACTATTACACTAATTAAAGGAAAGATTGAAGAAGTTCATCTTCCTGTAGAAAAAGTAGATGTTATCATATCTGAGTGGATGGGCTATTTTCTTCTGTTTGAGTCTATGTTAGATTCTGTCCTTTATGCAAAGAACAAATACTTGGCAAAAGGAGGCTCGGTCTACCCTGACATTTGCACTATCAGCCTTGTAGCAGTGAGTGATGTGAATAAACATGCTGATAGAATTGCTTTTTGGGATGATGTCTATGGCTTCAAGATGTCCTGCATGAAGAAAGCAGTTATTCCAGAAGCTGTTGTGGAAGTTTTAGATCCGAAGACTCTTATTTCAGAACCTTGTGGTATTAAGCATATAGATTGCCATACGACGTCTATCTCAGATTTGGAATTTTCATCAGATTTTACCCTGAAAATCACAAGGACATCCATGTGCACGGCAATTGCTGGCTACTTTGATATATATTTTGAGAAGAATTGCCACAACAGGGTCGTGTTCTCTACGGGCCCTCAGAGCACCAAAACACACTGGAAACAAACAGTATTTCTACTGGAAAAACCATTTTCAGTTAAAGCAGGTGAAGCCTTGAAAGGAAAGGTCACAGTTCACAAGAATAAGAAAGATCCACGTTCTCTCACCGTGACCCTCACGTTGAATAATTCAACTCAAACTTATGGTCTCCAGTGAAACAGCCATAAAAGCACACTACCTTGTAGTTTTTAATGTGGGGGTAGAGTGGGTCAGCAGGAGGGAGCTGGTTTTATGTGAGCAGATGGATGGATGATGGACCCTTTCCTAATGAGCCTCCTCAATAAGAGAGAAGTTCTCATTGTGGGAATCTGACATAGTTCAGCTGAGGAAGAGAATCAGCTGATCCTCATGGTCTGCCACGTAATCATTTTCTTAGACGTTTGCTCCACCAGATTTAACCAAATGTAACTCCCACATTGAGTTTATCTATATTGAAAATCATTTACATTGGCCTATATTTGGAAGAGAGATAG