Transcript asmbl_29744

Sequence
Transcript Sequence for observation asmbl_29744 of TGE0018703:
GATGCTTTGCGCTTTTGCTGGAGTCGGTCGTTTTAGAAGTGTCCCTTTCCTGTCGCGAGTTGCGTGGAGTCAGCTCGCGGGTCTCCGAGACTCGAGAACTTGAGAACTTCTTTGCGTCCGGGGGATTGCGCCCCGCGGCTCGGCGGCCGTAATCATGCCACAAAACGAGTATATTGAGTTACACCGTAAGCGCTATGGATATCGTTTGGATTACCATGAGAAAAAGAGAAAGAAGGAAGGTCGAGAAGCTCATGAACGTTCAAAGAAGGCAAAAAAGATGATTGGTCTCAAAGCTAAGCTCTACCATAAACAGCGCCATGCTGAGAAGATACAAATGAAAAAGACTATCAAGATGCATGAAAAGAGAAACACCAAACAAAAGAATGATGAAAAGACTCCACAAGGAGCAGTACCTGCCTATCTACTGGACAGAGAGGGACAGTCCCGAGCCAAAGTACTTTCCAATATGATTAAACAAAAACGAAAAGAGAAAGCGGGAAAATGGGAAGTCCCTCTGCCCAAAGTTCGTGCTCAGGGGGAAACAGAGGTATTAAAAGTTATTCGAACAGGAAAGAGAAAGAAGAAAGCATGGAAGAGGATGGTTACTAAAGTCTGCTTTGTTGGAGATGGCTTTACTCGAAAACCACCTAAATATGAAAGATTCATTAGGCCAATGGGCTTACGTTTCAAGAAGGCCCATGTAACACATCCTGAACTGAAAGCCACCTTTTG