Transcript asmbl_29353

Sequence
Transcript Sequence for observation asmbl_29353 of TGE0002767:
CAGGAGAAGAAACTAAGACCTGGAGTTTGAGTAATTCTTTCAAAGCTACCGAGTTGATAGAGGGACGAGAACAGAATCACCAGCACTGGCTGAAGGTACCTTAACATGGGGAATCTTCTTAAAGTTTTGACATGCACAGACCTTGAGCAGGGGCCAAATTTTTTCCTTGATTTTGAAAATGCCCAGCCTACAGAGTCTGAGAAGGAAATTTATAATCAGGTGAATGTAGTATTAAAAGATGCAGAAGGCATCTTGGAGGACTTGCAGTCATATAGAGGAGCTGGCCATGAAATACGAGAGGCAATCCAGCATCCCGCAGACGAGAAGTTACAGGAGAAAGCATGGGGCGCGGTCGTTCCGCTCGTAGGCAAATTAAAGAAATTCTATGAATTTTCTCAGAGGTTAGAAGCAGCATTAAGAGGTCTCCTGGGAGCCCTGACAAGTACCCCGTATTCTCCCACCCAGCATCTAGAGCGAGAGCAGGCTCTTGCTAAACAGTTTGCAGAAATTCTTCATTTCACACTCCGGTTTGATGAACTCAAGATGACAAATCCTGCCATACAGAATGATTTCAGCTATTACAGAAGAACGTTGAGTCGCATGAGGATTAATAATGTTCCAGCAGAAGGAGAAAATGAAGTAAATAATGAATTGGCAAATCGAATGTCTTTGTTTTATGCTGAGGCAACCCCAATGCTGAAAACCTTAAGTGATGCCACCACAAAGTTTGTATCAGAGAATAAAAATTTACCAATAGAAAACACCACAGATTGTCTAAGCACCATGGCTAGTGTATGCAGAGTCATGCTGGAAACACCGGAATACAGAAGCAGATTCACAAATGAAGAGACGGTGTCATTCTGCTTGAGGGTTATGGTGGGCGTCATAATACTCTATGACCACGTACACCCCGTGGGAGCGTTTGCCAAAACTTCAAAAATCGACATGAAAGGTTGTATCAAGGTTCTTAAGGACCAGCCTCCTAATAGTGTAGAAGGTCTTCTCAACGCCCTCAGGTACACAACAAAACATTTGAATGATGAGACTACCTCCAAGCAAATTAAATCCATGCTGCAATGACACTTCTGGAATAAGCACCTGCTGTAGACAGAAGACAGTATTCTGCAGTGACTGAGAATGCACAGTTTTTTAGTGATTGCAATTACTATCTCATTTACTCTTGCTTTTTATTTCTTTCCTCTGTTCCTCTTCCCTCTTTTTTAATCATGTTCTTGTTCTTAAGACTTCTTTTCTGTGCCAAAATCAGTAAAGTTATACTCTGAAGGGATATTGTCCTTTCAAACAGGCCGTCTAAGGCAGCTAATTATGCATTGCATTGGGGTCTCTACTGAGAGAAATTCTGTGACTTGAACTAAATATTTTTAAATGTGGATTTTTTTTGAAAACTAATATTTAATATTGCTTCTCCTGCATGGCAAAACTGCCTATTCTGCTATTTAAAAACCCTCAATGACTTTATTTTCTACTGCCGCTTTTTTCATGTGCAGCCAAAATGAAAATGTTTAAATTAACTGTGTTGTACAAATGGTACCCAACACAACCTTTTTTTAAATTAGTAAGACTTTTGTTTAAAGTTTTAAGTTTGCATTTTCACTTTTTTGTAAGGATGTATGTTGTGTGTTTAACCTTTATTAACTAACGTTAAAAACTGTGATGTGTGCGTAGAGTATTACGTATGCATGTTCATGTTTAAAGAATGGCTGTTGATAAAATAAAAATCAGCTTTCATTTTTCTAA