Transcript asmbl_28800

Sequence
Transcript Sequence for observation asmbl_28800 of TGE0004797:
GGCTGACATCACCACAGCAGCAGTCTTTAAACCCCTCATCCAGCCAGCGCCCCATCCTGTCTGTCCAAGTCCAGACAGAGCTGACTCCTTCCTTCAAGCCTTGAAGAGCCCCTCTCTCCCTAAACATGGCCAACAAGGGACCTTCCTACGGCATGAGTCGTGAAGTGCAATCCAAAATTGAGAAGAAGTACGACGAGGAGCTGGAGGAGCGGCTGGTGGAGTGGATTGTGGTGCAGTGTGGCCCTGACGTGGGTCGCCCAGACCGCGGGCGCCTGGGCTTCCAGGTCTGGCTGAAGAACGGCGTGATTCTGAGCAAACTGGTGAACAGCCTGTATCCTGATGGTTCCAAGCCAGTGAAGGTGCCTGAGAACCCCCCTTCCATGGTCTTCAAGCAGATGGAGCAGGTGGCTCAGTTCCTGAAGGCAGCTGAAGACTATGGAGTCACCAAGACTGACATGTTCCAGACTGTTGACCTCTTTGAAGGCAAAGACATGGCAGCAGTACAGAGGACCCTAATGGCTCTGGGCAGCTTGGCAGTGACCAAGAACGATGGGCACTACCGTGGAGATCCCAACTGGTTTATGAAGAAAGCCCAGGAGCATAAGAGGGAATTCACAGAGAGCCAACTGCAGGAGGGAAAGCATGTCATTGGCCTACAGATGGGCAGCAACAGAGGGGCTTCCCAGGCTGGCATGACGGGCTACGGACGACCTCGGCAGATCATCAGTTAGAGGACGAGGGCCAGCCCCCAGTCCTTTCCTGCCCCGGCTCATTGGCTGCAGCCATCTATCCTGCCTAGCCCACCTCACCCACACCCGTGTAATTCCTTCAGCCCCGGCCAAGCTTCGAGTCTCCGAGGCTCTGTCACTGAGCAAAGGTGACTTGCGCTTGGGCAACTCTCCCCACCCTCCTCAGCCTCAGCTGAACTTCTTACCCCAAAGCACTGCTCCCTGGGCCCTCCTTCAACCTCCCACCACCTCTACTGAGCTGAGCAAGGGGGTGTGGGCTGGGGGTGGTCTGGGTGTGGGGCAAGTCCACTGCGCTCCTTGGCAGCAGATGCCCATTGAAGGAGACCCAGCCCAACCTCCCCCCATTTTTTGCTGGAATATTTTGGGGGTTGAAATTCAAGAAGGAAAAAAAAATATATATATATATCTATA