Transcript asmbl_28655

Sequence
Transcript Sequence for observation asmbl_28655 of TGE0004785:
TGCTGCTCTGGCTACGGGAGAGTGACCCTGTGAGCATTGGGTCTTGTCGTGGCGATGGCCTCGTTCGTGACAGAAGTTCTGGCACACACGGGGAGTCTGGAGAAGGAGGATCTGGGCACTCGGATCAGCCATCTGACTCGGCGGGTGGAGGAAATCAAGGGTGAGGTGTGCAGTATGATCAGCAAGAAGTACAGTGAATTCTTGCCTAGCATGCAAAGTGCACAGGACCTTGTTACACAAGTGGACAAGCTATCTGATGACATTGACCAGCTGAAATCCAGGATAGAGAGTGAGGTCCGCCGGGATCTTCATGTATCAACCACTGAATTTACAGACTTGAAACAGCAATTGGAAAGAGACTCGGTAGTCCTCAGTTTGCTTAAACAGCTACAAGAGTTTTCTACTGCTATTGAAGAATATAATTGTGCATTAGCAGAGAAGAAGTATGTCACTGCTGCTCACCGTCTAGAAGAGGCACAGAACTGCTTGAAGTTATTAAAATCCAGAAAATGCTTTGATTTAAAAATGTCGAAATCTCTCAGCATGGAGCTTACGATACAGAAACAGAACATACTGTATCACCTTGGAGAGGAGTGGCAGAAGCTGATTATATGGAAGTTCCCACCATCAAAAGATATGAGCAACTTGGAATCTTGTCTACAAACAGAACTTCATTTATACACTGAACAGTCTCAAAACGAAGAGAAGACCCCTGTGCCACCAACCAGTTCTGTCCTCTTGGCATTTTCTATTCTAGGAGAGCTACATACCAAGCTTAAATCATTTGGTCAGATGCTGCTGAAGTATATTCTTAGGCCTTTGGCAACTTGCCCCTCCCTTTTTGCTGTGATAGAAAGGCAGCCTAACATCATTATTATTCGTTTTGAATCTGTGATGACTGACTTGGAACATCCATCACCATCTGAAGTTTTTGCGAAGATCAGACTGGTGTTGGAAGTGCTGCAGAAACAACTAGATTTCCCTCTTGATGCTGATCTAGAAAATGAAAAAACATCTAAGATCATATTGGCTGAGATGCTTGGTGACACGATCTGGGAAGACTTGTCTGAGTGCCTCATTAAAAACTGTTTGGTTTATTCTATCCCAACAAATAGCAGCAAGTTACAGCAGTATGAGGAGATCATACAATCCACTGAAGAATTTGAAAATGCCTTAAAGGAGATGAGGTTTTTAAAAGGAGATACTACTGATTTGCTGAAATATGCCCGTAACATCAATTCTCATTTTGCTAACAAGAAATGTCAGGATGTGATTGTGGCAGCTAGAAATCTAATGACCTCTGAAATTCACAACACTGTGAAGATTACTCCTGATTCTAAGATAAGTGTACCTGACTTACCCAGCCCTGATGTGGATGACAAGCTACAAGTACAGAAAATGTCCATAACTCAGTACAGTGAAGTGGTGAATTTAGAGCCTGAAAATACATTGGACCAACATTCCTTTTCTTTGCCCACATGTCGTGTCAGTGAATCTGCGAAGAAATTAATGGAACTTGCCTATCAGACTTTACTAGAGGCGACAACCAGCAGTGATCAGTGTGCTGTTCAACTTTTCTACTCAGTAAGGAATATCTTCCATTTATTCCATGATGTCGTACCAACATATCATAAGGAGAACCTTCAAAAACTGCCCCAGTTGGCTGCCATTCACCATAACAACTGTATGTATATTGCTCATCACTTGCTGACCCTGGGACATCAGTTCAGATTTCGTCTTGCTCCCATTCTTTGTGATGGCACTACTACTTTCGTGGATCTTGTACCTGGCTTTAGGAGACTTGGGACAGAGTGTTTTTTGGCCCAAATGCGAGCACAGAAAAGAGAACTTCTGGAAAGATTATCAAGTGCTAGGAACTTTTCAAACATGGATGATGAAGAGAACTATTCTGCAGCAAGTAAAGCAGTCCGTCAGGTACTGCACCAACTAAAGAGACTTGGAATTGTGTGGCAGGATGTCCTGCCCGTGAATATATATTGCAAGGCTATGGGGACTTTACTCAATACTGCAATTTCTGAGATCATTGGCAGAATCACTGCCCTAGAGGACATCTCTACTGAAGATGGTGATAGATTGTATTCCTTATGCAAAACAGTGATGGATGAAGGACCTCAAGTATTTGCACCTCTATCTCAGGAAAGCAAGAACAAGAAATATCAAGAAGAGGTTCCAGTCTATGTGCCAAAATGGATGCCATTTAAAGAATTAATGATGGTGTTACAGGCCAGCCTGCAAGAAATTGGGGATCGGTGGGCAGATGGAAAAGGGCCCTTGGCAGCTGCATTCTCTTCCAGTGAAGTAAAAGCTTTAATTCGTGCCTTGTTCCAGAACACAGAAAGAAGAGCAGCTGCCCTTGCTAAGATTAAATAGCTCCACCTTCCCGAGAAAGCCATGTCTTTACTATGGATTTCTCTCTTGGCATAATTACTCATTTAGAGACTTCTTAGAGTCACCCACTGGTTTTGGTGAACCAATATATCATGGAAGTTTTATTTCACCTAAGAACGCCTTACCTCTTGGCTTGTAGGAGGCCATGTTGAATAACTGGATGTTAAGATGTCAAGTGAAGCACCTTACTTTGTTGAATTTCTAGCCACCCTTCTTAGATAAGAAACTGTAGAGCAGCATTGTTTTATGTTACTTCTAGGGCCTTCTGGGAACCATATCCATTGTAAATGTAGGCCCTGGCCTCGGATCAAGGAATCCAGGAGATTCCAGGAGTCAGGGTAAAGAATTTGTGAGCAAACAGGAGATATATTTTGGGGGGTAGGGGAACCATATTTGGCTTTGCAGAAATTAAGAAGACTTCCTTTAAGATTTTTTCCAATAAATAATGCTTTTAA