Transcript asmbl_28541

Sequence
Transcript Sequence for observation asmbl_28541 of TGE0004779:
GGGCGAGGCGGTGCCTGCGAGCGCGAGGTCCGCGCTGTGCTCGCTCGGAAGATCGCTCCTCTGCATCTGGGCGCCGACGGCGGCTCGGCGGCTCGCGGAGGATCGAGAGGGCGCCGTCTGGGTCGGAGGCTTTCCCCTGGCCGCCTCGCGCCTCGTCGCCCCCGGGGAAAGCCGCGGCCCCGAAGGCAGATCCAAGGTCACCTGTAATACGGCTCTCATTGGACTGGAGTGGAAACATAAGGATTAGAGAATATTTTCATTTTTGAGAACATATGGGTGAAAGTCACGATGAATGGTCATATTTCTAATCATCCCAGTGGTTTTGGAATATATCCATCTCAAATGAATGGCTACGGAACATCATCCACCTTTTCCCAGATGGACCGAGAACACAGTTCAAAGCCAAGTGCAAAGGCCCTTTATGAACAAAGGAAGAATTATGCACGTGACAGTATCAGCAGTGTATCAAATACAACCCATTACCATGTTGAACACTTGACTACCTTTGTTCTGGATCGGAAAGATGCTATGATAACTATTGATGATGGAATAAGGAAGCTGAAATTGCTTGATGCCAAAGGCAAAGTGTGGACTCAAGACATGCTTCTTCAAGTGGATGACAGAGCCGTGAGCCTGATTGATTTAGAATCAAAGAATGAACTGGAGAATTTTCCTTTTAACACAATCCAGCACTGCCAAGCTGTGATGCATTCCTGTAACTATGATTCAATTCTTGCCCTGGTGTGCAAAGAGCCAACTCAGAATAAGCCAGATCTTCATCTTTTCCAGTGTGATGAAGTTAAGGCAAACCTAATTAGTGAAGATATTGAAAGTGCAATCAGCGACAGTAAAGGAGGGAAACAGAAGAGGCGGCCTGATGCCCTGAGGGTGATTTCCAATGCAGACCATGGAATACCGCCTCCGCCCAGAGCTCCTGCTCCCGTGCCCCCTGGGACTGTTACCCAGGTGGATGTTAGAAGTCGGGTGGCAGCCTGGTCTGCATGGGCAGCTGACCAAGGGGACTTTGAGAAACAAAGGCAGTATCATGGGCATGAAGAAACACCTGAGATGATGGCAGCCCGAATTGACAGAGATGTGCAAATCTTAAACCACATTTTGGATGACATTGAATTTTTTATCACAAAACTCCAAAAAGCAGCCGAAGCATTTTCCGAGCTGTCTAAAAGGAAGAAAACCAAGAAAGGGAAAAGGAAAGGGCCAGGAGAGGGTGTTTTAACACTGCGGGCAAAACCCCCACCTCCTGATGAATTTATTGACTGTTTCCAAAAGTTCAAACATGGATTTAACCTTCTGGCCAAATTGAAGTCTCATATCCAGAATCCCAGTGCTGCAGATTTGGTTCATTTTTTATTTACTCCATTAAATATGGTGATACAAGCAACAGGAGGCTCTGAACTAGCTAGTTCTGTACTCAGCCCCTTATTGACTAAGGACACAATTGATTTCTTAAATTATACTGTCAATACCGATGAAAGGCAGCTGTGGATGTCATTGGGCGAAACTTGGATGAAACCCAGAGCAGAGTGGCCAAAAGAACAGTTTATTCCACCATACGTTCCACGGTTCCGCAATGGTTGGGAGCCCCCAATGCTGAACTTCATGGGAGCACCGGTGGAACAAGATATTTATCAGCTGGTTGGGTCTGTGGCAGGTGCAGCAGAACAACACAGACATGAAACAAAAAGATATGCCACTGAGCAATCCAGTGTATTAGAATATGCTCCACCTCCACCTGATGGGTATGCATTCAATAACATTTACACAAGAGGGACCCATCTGGACCAAGGGGAAGCCGCTGTTGCTTTTAAGCCAGCTCCTAATCGCCATGTAGATAGAAATTATGATCCACTCATAACACAACCCAAGAAATATGCCAAATCCAAGTATGACTTTGTGGCAAGGAACGGCAGTGAGCTCTCAGTTCTAAAGGATGATATTTTAGAGATCCTCGATGATAGGAAGCAATGGTGGAAAGTTCGAAATGCAAGTGGAAACTCTGGATTTGTGCCAAATAACATTTTGGATATCGTGAGACCTACAGAATCTGGAGTAGGGCGTGCTGACCCACCGTACACACATACCATACAGAAACAAAGGATGGAGTATGGTCCAAGATCAACTGACCCTCCCTCTGCTCCGTCACCTCCTCCAACACCAGCTCCTGTTCCTGTCCCCCTTCCACCTTCTATTCCAGCACCTGTTCCTGTGTCAAAGGTCCCAGCAAATGTCACCCGTCAGAATAGCAGCTCCAGTGACAGTGGTGGCAGTACTGTGCGAGATAGCCAGAGACACAAACAACTTCCAGTGGACCGAAGGAAATCTCAGATGGAAGAAGTGCAGGATGAACTCATCCACAGGTTGACCATTGGTCGGAGCGCAGCCCAGAAGAAGTTCCATGTGCCACGGCAGAATGTGCCAGTTGTCAATATCACTTATGACTCCACTCCAGAGGATGTGAAGACGTGGTTACAGTCAAAAGGGTTCAATCCGATGACTGTCAATAGTCTTGGAGTATTAAATGGTGCACAACTTTTCTCTCTGAATAAAGATGAACTGAAGACTGTCTGCCCTGAAGGGGCAAGAGTCTTTAACCAAATCACCGTACAAAAAGCTGCATTAGAGGACATCAGTGGCAGCTCCGAGTTACAAGAAATTATGCGAAGACGACAGGAAAAAATCAGTGCTGCTGCCAGTGATTCAGGAGTGGAATCTTTTGATGAGGGAAGCAGTCACTAATTTCTTTATATGTTTGTTTTTAAACTCCATTTAAACTTTTGGCATTATTCTAACGTGCTTTGTTTTAAGAAGCCATGAAGGGAATGTCAGATTCTTATCTCTTGGTATACTTAATTTATCGCCATACAATAACAATGCAAACGTAAGTAAGCAGAGGACTTGCTCCTGGGCCCTTTATTTTTACTAAAACTGAGAATTTTTAAATAGAATTTTTTGACCTTGGGAAATATTTTGTTTACTTTACCAAGGTGAAGTTTCCTTTACTGGATTATGTCATTATAATTTCAATGTATAA