Transcript asmbl_28540

Sequence
Transcript Sequence for observation asmbl_28540 of TGE0004778:
GCTAACTTCCTTCCTGTTCTAACTGCCAGTACTCAGAAGTCAGAGTTAAGAGACAGAGGCACCCCGGACAGAGACGTGAACAACTGAATATCAAAATGACTGAAAAAGCCCCAGAACCACACCTGGAAGAGGATGATGATGAACTGGACGGCAAGCTCAATTACAAGCCTCCACCTCAGAAGTCCCTGAAAGAGCTGCAAGAGATGGACAAAGATGATGAAAGTCTAGCTAAGTACAAGAAAACACTCCTGGGAGATGGTCCTGTGGTAGCAGACCCAACAGCCCCCAATGTCACTGTCACCCGCCTTACCCTGGTATGTGAGAGTGCCCCAGGACCAATCACCATGGACCTCACTGGGGATCTTGAAGCCCTCAAAAAAGAAATTTTTGTGCTAAAAGAAGGTGTTGAATATAGAGTCAAAATTCACTTCAAAGTGAACAGAGATATTGTGTCAGGCCTAAAGTATGTTCAGCACACCTACCGGACTGGGGTGAAAGTGGATAAAGCCACATTTATGGTTGGCAGCTATGGGCCTCGACCAGAGGAGTATGAATTCTTGACTCCAATTGAGGAGGCTCCCAAGGGCATGCTGGCCCGAGGCACCTACCACAACAAGTCCTTCTTCACCGACGATGACAAGCACGACCACCTCACCTGGGAGTGGAATCTGTCCATTAAGAAGGAGTGGACAGAATGAGCACGTCTGCCCCTTACTGTCCCTACCCTTGGCACTTGGAAGAACCCTCTCAGTCATGTTCACTGCACTGTCCCTTCTCCCTGATCACAGCTGGACCCCTTTCCCAACACCCCCACATCGTCTCTCTGATGCATCTTCTCCCACACTCTCTCAAAGTGGTCCCTGGTACTGGATGCTTAAAACCCAAGCTTCAATCCTGCCCACTCCTTCTGACTCCCATCACGGCCAGACCTTCGAAGTTCTCCACCTCAATACACGATCATTTAATATCTCTTATTCCCATTTGAACAGCTAGAGGCCAGGAAATGGGCGAATGATCACTAATTGTTCTTTTGCCTTCGGTTCCAAGGCTCATTCTCACCCCTGGATTCTTCTGTGGTTGCTGCTGGCTCTATGAAGGTCCCTAGTCACATTCCCTGCCAGATGGGTTCTTCTTTTCTGGGAGACACTGTAAACAGCACAAGAGAGTAAGAATAAAACAATCGTATGATCTGACTGAGA