Transcript asmbl_28166

Sequence
Transcript Sequence for observation asmbl_28166 of TGE0004737:
GTTATTTTCTGCTATCCACCCTAGCTGGAATTTATGCCAGCCTTGGGGGCTTTCTGCTCCCTCCTCCAGTGAGGAAGAGTCTCAGAAGCCCCTCTAATGCAGGTTAAAGAGGTTCAGTCTAGCTAAGGTCAGCTCCCTAGGGCCTCCGCAGTCTGTCTCCTGGGTTAAGAGCTGGCTTTGCAAGAAAAATCTGTGAAGCCTGAGATGCAAGGTTATTAACCCCATTTTCAGCTCTTCATGGCGGGGCTTGGAAGAGGGTGAGGAGAAGGGGTGACGGGGACCGATCTGGGTACCCTCGGCAAATGTTCCGGCGGGCTCCCAGGGAAAAGCCAGTGTCCTCCCCAGCCTAAGGCCGCGGCGACCGAGCCAGGCGAAGGGACCGGGGTACCCCTCACCCTCCAGGAGCTCTAGAGACCCAGGACCATGGACAATTTCAATAGGAACCAGGTAGGCCCTGGATGCAAGACCCAAGTAATGGTGCAGAAAGGACCATTGGACCTGATTGAGACAGGCAAAGGGCTGAAAGTACAAACAGACAAACCCCATCTGGTGAGCCTGGGCAGTGGGCGACTCAGCACAGCTATCACCTTTCTGCCGCTGGAAGAAGGGAGGACAGTGATTGGCTCTGCAGCCAAGGACATCTCACTGCAGGGTCCAGGCCTGGCTCCAGAGCACTGCTACATCGAGAACCTGCGGGGCACCCTCACCCTCTACCCTTGTGGTAATGCCTGTGCTATTGATGGACTCCCTGTTCGACAGCCCACCCGGCTCACTCAGGGCTGTATGTTGTGCCTGGGTCAATCTACCTTCCTCCGCTTTAACCACCCGGCTGAAGCCAAGTGGATGAAAAGCATGATTCCTGCCGGGGGCCGTACTCCTGGGTCTCCGTACAGTCCTGGCCCAGAATCAGAAAGCCTGGTGAATGGGAACCATACCCCACAGCCTGCAACTCGGGGACCCTCTGCCTGTGCCAGCCACAGTTCCCTGGTGAGCTCAATTGAGAAGGACCTGCAAGAAATCATGGATTCACTGGTGCTAGAGGAACCTGGAGCTGCTGGCAAGAAGCCTGCCACAACTTCCCCACTGTCGCCGATGACTAATGGTGGTCGTTACCTGCTGTCCCCCCCAACCAGCCCTGGTGCCATGTCTGTGGGTTCCAGCTATGAGAACACCTCTCCAGCCTTCTCTCCACTCTCCTCACCAGCCAGCAGTGGAAGCTGTGCCAGCCACTCACCCAGTGGGCAGGAGCCAGCATCTTCCACACCCCCACTAGTGCCTGCCCGTTCCTCTAGCTACCATCTGGCCCTGCAGCCCCCACAGTCCCGACCTAGTGGTGCCCGCTCCTCTGAGAGCCCCCGGCTGGGCAGGAAAGGGGTTCATGAGAGGCCTCCCAGCCCTGGCCTCCGGGGTCTGCTGACAGACAGCCCTGCATCTACTGTCTTGGCGGAGGCCCGCAGAACCACTGAGAGCCCCCGGCTATGTGGGCAGCTGCCTCTGGTGGCTATCAATCTGAGTGAATACTCGGCTTCTGGTGCCCACAGTCAACCCACCAGCATTCCTGGCAGTCCCAAGTTCCAGTCTCCAGTCCCTGCTCCCCGAAACAAGATTGGCACACTTCAGGACCGCCCTCCCAGCCCTTTCCGTGAGCTTCCAGGCGCTGAGCGGGTATTGACAACCAGCCCCTCACGCCAGCTGGTGGGCCGAACATTTTCAGATGGTTCAGCTACCCGCACCCTGCAGCCTCCTGAAAGCCCCTGCCTGGGCCGACGGGGCCTGGACAGTATGCGAGAACTCCCTCCCTTGAGCCCGTCTCTGTCCAGACGAGCTCTCTCCCCCATGCCCTCCCGGAATACTCCAGATCCCAAACTAACTAGGGAAGTGGCAGAGAGTCCCCGGCCGCGGCGCTGGGCAGCCCATGGGACTTCACCAGAGGACTTCTCCCTGACACTGGGGTCGCGGGGCCGGAGGACACGGAGCCCCTCACCCACACTCGGGGAGTCCCTGGCACCCAGCAAGGGCAGCTTCAGTGGCAGGCTGAGCCCAGCTTACAGTTTGGGCTCTTTGACTGGGGCTTCGCCCCGTCAGAGCCCCCGTGCCCAGAGGAAACTCTCCAGCGGGGACTTACGGGTGCCTGTCACTCGAGAGAGGAAAAATAGCATCACGGAGATCAGTGACAATGAGGATGACCTCCTGGAGTACCACCGGCGGCAGCGCCAAGAACGGCTTCGGGAGCAGGAGATGGAGAGGCTGGAACGCCAGCGCCTGGAGACCATCCTGAATCTGTGTGCCGAGTACAGCCGGGCTGATGGGGGACCTGAGGCCGGAGAGCTGCTCAGCATTGGGGAGGCCACTGCAGCATTGGCACTGGCAGGCCGGAGGCCCTCACGAGGCCTTTCAGGAACCACTGGGGCCTCTGGGCGGAACAATGAGGAGCCTGGAAGTGCCACCCAACGCCTGTGGGAGAGTGTAGAACGCTCAGATGAGGAAAATCTCAAGGAGGAGTGCAGTAGCACTGAGAGCACCCAGCAGGAGCACGAAGATGCACCTAACACCAAGCTCCAGGGAGAAGTGTTGGCCCTGGAAGATGAACGGGCTCAGGTGCTAGGGCGAGTGGAGCAGCTCAAGGTCCATGTGAAGGAGCTGGAGCAGCAGCTGCAGGAGTCAGCTCGAGAGGCTGAAATGGAGCGGGCGCTGCTGCAGGGGGAGAGGGAGGCAGAGCGGGCACTGTTGCAGAAGGAGCAGAAAGCAGTGGACCAGCTGCAGGAGAAGCTGGTGACTTTGGAGACAGGCATCCAAAAGGAGAGGGACAAGGAGGCAGAGGCCTTGGAGACTGAGACAAAGCTCTTTGAGGACTTGGAGTTCCAGCAGCTGGAGCGAGAGAGCCGCGTGGAGGAGGAGCGCGAGCTGGCGGGCCAGGGGCTGCTCAGAAGCAAGGCCGAGCTATTCCGCAGCATCGCCAAGAGGAAGGAGCGGCTGGCAGTCCTGGACAGTCAGGCTGGGCAGATCCGGGCTCAGGCTGTGCAAGAGTCTGAGCGCCTGGCCCGGGACAAGAATGCCTCCCTGCAGCTGCTGCAGAAGGAGAAAGAGAAACTGACTATGTTGGAAAGAAGGTACCACTCACTCACAGGGGGCAGACCTTTTCCAAAGACCACATCAACCCTCAAAGAGAATGCTCCACTCATCCAGAATGGCACAGGCAGCCTTCCTCGCAACCTGGCAGCCACACTGCAGGACATCGAGACCAAGCGCCAACTGGCCCTGCAGCAGAAGGGGCAGCAGGTGATTGAGGAACAGCGGCGGCGATTGGCTGAGCTGAAGCAGAAAGCAGCAGCCGAGGCTCAGTGCCAGTGGGATGCTCTGCACGGGATGGCCCCCTTCCCAGCAGGCCCCTCGGGCTTCCCCCCACTCGTGCACCACTCCATCCTGCATCACCTGCCAGCTGGGCGGGAACGTGGGGAGGAGGGCGAGCACGCCTATGATACACTGAGCCTGGAGAGCTCTGACAGCATGGAGACCAGCATCTCCACAGGAGGCAACTCCGCCTGTTCCCCCGACAACATGTCCAGTGCAAGCGGCCTGGACGTGGGGAAGATCGAGGAGATGGAGAAGATGCTGAAAGAAGCTCATGCAGAGAAAAGCCGACTCATGGAGTCGAGGGAGCGGGAAATGGAGCTGCGGAGGCAGGCACTGGAGGAGGAGCGGAGAAGGAGGGAGCAGGTGGAACGGAGGCTGCAGAGTGAGAGCTCCAGGAGGCAGCAGCTGGTGGAGAAGGAGGTCAAGATGCGGGAGAAACAGTTTTCTCAGGCACGACCTCTGACCCGCTACCTGCCAAACCGGAAGGAGGACTTTGACTTGAAGACCCACATCGAGTCGTCAGGACATGGCGTCGATACCTGCCTGCACGTGGTGCTCAGCAGCAAGGTCTGCCGTGGCTACTTGGTCAAGATGGGCGGCAAGATTAAATCGTGGAAGAAGCGCTGGTTTGTCTTTGACCGGCTCAAGCGCACCCTTTCCTATTATGTGGACAAGCATGAGACAAAACTGAAGGGGGTCATCTATTTCCAGGCCATTGAGGAGGTATACTATGACCACCTGCGCAGTGCAGCCAAGAGCCCAAACCCAGCCCTCACCTTCTGTGTGAAGACCCATGACCGGCTGTACTACATGGTAGCCCCCTCTGCAGAGGCCATGCGCATCTGGATGGATGTCATTGTCACCGGGGCTGAAGGCTACACTCAGTTCATGAACTGACTGGCATGGGCCTTCTGGACCCTCAGGCCAGCCCCAGGACCCATGCCTGACGATGGCTGCTCTCTTTGGCCCTGGAGACAGAGTCACACCCTGGACTCCAGGCCTCACTGGGGCACTCCCAGAGGACCTGGGAGGGCAGAGTGTGCCTGGGGCTTTTGTACAAGACTTTGTAATGTTGTCTAAGGAGCTCATCCTGGGAGTTTCTGAGCTTGGCCCTCTAAAGAACCAGCCAGGAGATAAAAGGTAGGATGGGGCTTTACTGCCTCCTGGGAGCCCAGAACTTGCAATAACTCTTTAGGGTCCTGCCCTCCCTAGCCTGTATTCTCTTTTGTAAAGAACAAATTATGGTACCTGAATCTGCCAAAGATCCCCTCTTGCCTCAGCCCCCTTTGCAGGGGACTTGAGGGATGAGCAGAGCCACATCCAGAGTGGGGTAATAGCTCAGGCAGTATACTTCTCAAACCCTGCTCTACCCAATTATTCTTCTGCAATTATATTTTTTATTACTTTGCTCAAGGGCCAGAGACCTCAAGTGTCATCCTTGAGGTCTCAGTCCCAACCCTTTTTGCAGACCCATTATCATGGTCACCATAGTAACTGCTTCATTGCCATGGTTACATACTAATTGCTGTGGCTCCATGGCTCAGCCCACTGCTTAAGCTGTGGGCCCATCTGAGGGTATGTGCCATCATCTCTCCAGCCCAAGACCTTGGGTATCTTATGCTGGGGGGAAGGGACTGATCACCTCCCTGCCTCCAGCCTGTGTCTCCAGGCTCTGATACACAGCCTGCTGCCCCAAACCCCCTGCCCTGGGCCAGCCCTCTCCCTTCCACTCGTGCCTTGCTTAGAGCCAGAAGGGATGAAGCTGGGGCTTCTAGATCCAGAGGAGGAGCAATGCGAATGGGAGATAAAGCTATAATGGCTGTCCTCAAGATTTCTGGGGCTGAGTTTCTGACAGGGACAGAGGGCTGCTTCCTTGGGAATGTGAGCAGGAGAGGGAACAGCAGAGAGGGAGGAGTCTGAGGTCCAGCTATGCTCCCTTCGGCCTCAGAAGGGCAATGAAAATGAAGAGCAAAGGTCCAGGCCTCCAGCTGTCCAGCCTCAGCCCTTCAAGCCTTAACATTAGCCCACCTCCCTGTCCCCTTTTCCAGCACTGGGACGTGATAGCTGGGCCCAGCTGAGTGATTTTCAGTATTTGTAAGCATCTCAGCAGAACAATAAAGCATTTGGAGTATG