Transcript asmbl_27533

Sequence
Transcript Sequence for observation asmbl_27533 of TGE0018602:
GCCGGCTGCACGAGCCACACCGTCTTCGGGCCGATCCGTGGTGGACGTTTTCGGAGTAGGCGAGCCGCAGCCTGTGCGCCCCCTCACCGTCTCCTGTGAAACCCTGAGCCGGCTGTGTAGCTTTCTCCCTTTGTCTCAACCATGTCCACCAACGAGAATGCTAATTCACCAGCTGCCCGCCTCAACAGATTCAAGAACAAGGGGAAAGACAGTACAGAAATGAGGCGGCGCCGAATAGAAGTTAATGTGGAACTGAGGAAAGCTAAGAAGGATGACCAGATGCTGAAAAGGAGAAATGTAAGCTCGTTTCCTGATGATGCTACTTCTCCACTGCAGGAAAACCGCAACAACCAGGGCACTGTAAATTGGTCTGTTGATGACATTGTCAAAGGCATAAACAGCAACAATTTGGAAAACCAACTCCAAGCTACTCAAGCTGCTAGGAAACTGCTTTCTAGGGAAAAACAGCCACCCATAGACAACATAATCCGGGCTGGTTTGATTCCAAAATTTGTGTCCTTCTTGGGCAGAACTGATTGTAGTCCCATTCAGTTTGAATCTGCTTGGGCCCTCACTAACATTGCTTCTGGAACATCAGAACAGACCAAGGCTGTAGTTGACGGAGGTGCTATCCCAGCATTCATTTCTCTTTTGGCATCGCCCCATGCTCACATCAGTGAACAAGCCGTATGGGCTCTAGGAAACATTGCAGGTGATGGTTCAGTTTTCCGAGACTTGGTTATCAAGTATGGTGCAGTGGACCCACTGTTGGCTCTTCTTGCAGTTCCTGATATGTCA