Transcript asmbl_27484

Sequence
Transcript Sequence for observation asmbl_27484 of TGE0000916:
CTGCCTTCGATCCTGGCCACTTCTCTCAATCATCGTCTTCTGATTCAGGGTGGCATTGTGTGTCCCGGAGTGCAGGAGCGAGTCCCAGAAGAGAGGCGAGGCTGAGCCCAGAGCGCTGGGCTGCTTCAGCAGGGAAGACTCCCTTCCCCCTGCTTCAGGCTGCCGAGCACTGAGCAGCGCTCAGAATGGAAGCCATCGCCAAGTATGACTTCAAAGCCACTGCAGACGACGAGCTGAGCTTCAAAAGAGGGGACATCCTCAAGGTTTTGAATGAAGAATGTGATCAGAACTGGTACAAGGCAGAACTCAATGGGAAAGATGGCTTCATTCCCAAGAATTACATAGAAATGAAACCACATCCGTGGTTTTTTGGCAAAATCCCCAGAGCCAAAGCAGAAGAAATGCTTAGCAAACAGCGGCATGATGGAGCCTTCCTTATCCGAGAGAGCGAGAGTGCTCCTGGGGATTTCTCCCTCTCAGTCAAGTTTGGAAACGACGTGCAGCACTTCAAGGTGCTCCGGGACGGAGCCGGGAAGTATTTCCTCTGGGTGGTGAAGTTCAATTCTTTGAATGAGCTGGTAGATTATCACAGATCTACATCCGTCTCCAGAAACCAGCAGATATTCCTCCGGGACATAGAGCAGGTGCCACAGCAGCCGACATACGTCCAAGCCCTCTTTGACTTCGACCCCCAGGAGGATGGAGAGCTGGGGTTCCGCCGGGGAGACTTTATCCACGTCATGGATAACTCAGACCCCAACTGGTGGAAGGGGGCGTGCCACGGGCAGACCGGCATGTTCCCCCGCAATTACGTCACCCCTGTGAACCGGAACGTGTAGGAGTCGAGGGGAGAGTATTTAAAGAAAGCGAAACATGGAAAACACGTCCAAAAGAATTCACCCCACGAGCTGCTCTAGCGGCAGCCTGCGAGGGGCTCGGAACACCTTGCCGGGTCACCCGATGACCCTCTCACCTGGTTGGAACTTTGGGGGGTGGGAGGGGGAGTTGGATATAACAATGCCAAAACTTACCTATAAATTAAGAAAAAGAGTTTTTATTACAAATTTTCACCGCTGCTCCTGTTTCTCTTCCTTTGTCCTTTTTTTCATCTCTTTTCCCTTCTGTCCATCAGTGCATGACGTTTAATGCCACATATAGTCCTAGCTGATGCCAATAATAAAAGAAAAGAAACCAAGTGGGCTGGTATTTTCTCTATGCAAAACGTCTGTTTTAGTCAGAATGACTGAAGGAACAGCCGTTGCTGGGCGCTTCATGTACACACGCAGAAGCGGCGGCTTCTGCCCAAGGAGGGGCGGGCGAGTAGGAATCCGCCTTCCAGCCCCCACCCCAGTGTCTCCGTCAAAGTTGGAAACAGAGAGGGGGTGAAAGGAGGCAGCGTTGCCCCTTATGACTTCCTGAGAAAGTCAAGCTGAAACCCGTGTCTCTCTCTCTCCGCGTTTTTCCCTTCCGAATGGTATTACTGAGCATGTCGTTTTTTATAGTGCCTTTTTCCTTATTTCAAGGGTTGCTTATGAGTGGTGTTCTTTTTGTTTTGTTTTAAAATAAGTTAAAGACAGTCTAGAGCTTTTCAGCTGGTGTGTCTCCTACTCTGTGTAAATATTGTTCCCTCAGGGGGAGGGGAGAACAGGGTAGAGAAGAGGAGGCAGGTAGAAGTGCGGGCTGCGGGCATTCTGCGTCCTAAGGCAGGAGAGGTTAAGGTTCAGCTTTGATACCTGTGAGCCCTCCGGAGTTTAA