Transcript asmbl_27470

Sequence
Transcript Sequence for observation asmbl_27470 of TGE0003178:
GACTGCGGCTCTTCGTTGGGCAGTGGGAGCGGTGCGGCGGTGGGAGAGGCGGCCTAGGGCTTCAGCGTTAGGTGAAAGAAAATGGCCCGAACCAAGCAGACTGCTCGTAAATCCACGGGTGGGAAAGCGCCCCGCAAACAGCTGGCCACTAAGGCTGCCAGGAAAAGCGCTCCCTCTACCGGCGGGGTGAAAAAACCTCATCGCTACAGGCCCGGGACCGTTGCGCTTCGAGAAATCCGTCGTTACCAGAAATCGACCGAGCTTCTGATCCGGAAGCTGCCTTTCCAGAGGTTGGTGAGGGAGATCGCCCAGGATTTCAAAACCGACCTGAGGTTCCAGAGTGCTGCCATCGGCGCTCTTCAGGAGGCTAGTGAAGCGTACCTGGTGGGTTTATTTGAAGATACTAATCTGTGTGCCATCCACGCTAAGAGAGTCACCATCATGCCCAAAGATATCCAGTTGGCTCGCCGGATACGGGGGGAGAGAGCTTAAGTGAAGGCAGTTTTTATGGTGTTTTGTAGTAAATTCTGTAAAATACTTTGGTTTAATTTGTGACTTTTTTTGTAAGAAATTGTTTATAATATGTTGCATTTGTACTTAAGTCATTCCATCTTTCACTCAGGATGAATGCGAAAAGTGACTGTTCACAGACCTCAGTGATGTGAGCACTGTTGCTCAGGAGTGACAAGTTGCTAATATGCAGAAGGGATGGGTGATATTTCTTGCTTCTCATGATGCATGTTTCTGTATGTTAATGACTTGTTGGGTAGCTATTAAGGTACTAGAATCGATAAATGTGTACAGGGTCCTTTTGCAATAAAACTGGTTATGACTTGATCCAAGTGTTTAACAATTGGGGCTGTTAAGTCTGACCATGCATCACTGTGATAGAATGTGGGCTTTTTCAAGGGTGAAGATACAAGTCTTAACCACAGTGTAACTTACAGTTTCCTTAAAAAAAGTAAACCTGGCAGCTATAGAATACACTATGTGCATTTATAATAGCTATTTTATATATTGTAGTGTCAACATTTTTAAATTAAATGTTTTACATTCACATGTGGTGGGGAGTCTTGTCATTAAGGTGTGTGTAATTTTAGAGTCCAGTTGGTTTTCTCCTAACTAGAGTGCACTTGTTTTCATAGTAGTAAAATGCTTTGCGCATCATACCTTGCATAAGTCCTCATTCTACCACATGTTAACTAACTCTAGCTGATAATGCAAACACTAACGGGGAATTTTATTTATAAGGGCTCTAGAATATAATACAAGTTATTCACACCAGCATCATCTGTTACTAATCTGAACTAGTTAGTGCAGCTTTTCTTTGTGTTGTGGTTGGTCTCATAACTAGGTTGAGTTTTTCTCTAAGTAGAGGAAACAATACGGAAATTCTTTTCCTTGTGGAGTTTGTATTATAAGGCTTAGAGTAAACTTGTGGTGGGGGAGGGGCACACAGCTCCAGCTTTTCGAACCTCAGCCAGTTAAGATGGCGTCTAGTGAGGTTACATCTGGTATATGGTTCTGGGGAAATCACTTTAGAGATGGTCTTCCAAGTGGTTTTTAAATTTATCCTTCTATTGAAGTTTTTAGGTCAATTATGTATGTTGACTAAATTTACAAATAAACTTGTTTATCCAACTAAGTGTCAAAAACCTAAATTGAATGTACAAACCCACCCATTATCTAGGTCCTTTGTATCTTAAAGTTTGAGTTTAGCTTTTTTAGGTTTTGCTTGGTAGATGAACCTTTTATTTACAAAAATAGTCATAGAAAGCATGTAAAAGTCCCTCTGCTCTGAAAAATGCCATGATTGCTATTTTTTGCAGTGCGGGCTTAAGACGTATTAATATGCTTCCCTTTGCCCCCATGTTGTCAAGGTATAAAAATTTGTCTATTCAAGGTATAACAGGTCAAGGAAAGTAAATTTCTTTAAAATTCGAGGGCTCAAATTTGGTATCTGTTCCAAGAACCTTTTCTGGCAGTATGTAGATCTCTACGTAGCAAATTATTTTAACAGAAGCGCAGAGGTAGAGAATTCATTGGTCTAAGCCACCTTTTCAGTATAAAAACTAGTTTTCTTGACCAATGATGGGCAGCAGTAAAGCTCAGTATATGTCAGCTGGATGTGGGCACAAGAGCCACCAATCATTAGGAGGTGTTCGGTATATTTAAAGTTAGCTGTAGGAACACATTTTTGCCCTAAAGGCTTTTTTAATAAGTTAGCATTAGTTTCAACTTTAAAGGGTTTGTGAAGAAGCTAGCTAGAGTAGCCTTGGGAGTCCTGGTTAAACAGCCTTAGGGGGGATATCAAAGGCGGAGTCCAATACAATACAAAATACAATGAATGGTTTTGTAAAAGGTCCATTATAACCAGTGCTTGGAACAATGACTGACTGAGAACTTATGTTGTTACTTCCGAAGGAAGTTGAAGTCCTAGACATTGGGATATGCTGTGCTCTGGAGTGTGGCAGTGTTTGAACACAAGTAGAAGCAGCTATGAGTTAGCTTGAGTTTCTACCTGTGGTAACAAGCGGGTAACGCTTGAACTTTACGCAGTCTGTGTCTTGATGTAGAAAGTTCTTGAATTTTATTGGGTGACTTGGAATTTGCTGCTTAAATAGTGTAACACTTCCATACTTTACTTGAGCACACATCACAGAAGGCAAAAATATTTTTTGGTTCTAGGAAGGTACCCACACAGGAGATAATCTGGGTATAGGTGATGGAACAGAGTCTGTAAGGAGAAAAGCAAAAATTGGAGCTGATGAAAGGTATCCTGTGCCCTTGATGGATGAGACAAAAATAAAGTTTTTGAAGTTGCAGACTTT