Transcript asmbl_27440

Sequence
Transcript Sequence for observation asmbl_27440 of TGE0008906:
GGAAAATAAAGTAAAACTATCTTTTAAAATGAAGAGTGGCTATCAGATCAACATATTGTACACGTTAAACTGACTCAGTATTATGTGTCAATTATATCTCAGTAAAAAGTTCTCATATATAAAAAATAAAATGGACGATTGCTTTGCCAGAATTCAATAAATTGTAATAACTATCGGCTTAAGTAGATTTCCTCCTGAAAACTGTGTGCGACACTCATAGGAAAGGCTCCCGGGCACAGTTGGCCAGGTTACTGACAGAGTCTAGCGTTCCATTTGACGTAAGCTTTTCCCCGCTTTTTTCTTTCTGTTCTTTGAAATTGTAAGAATGGTTGCTCACTCCCTCTCTTGTTCCGTTTGATGTCACAGTTGGAAAGACTTCAAATTATGCGATAGTGCTTGCCCAGCTCTACACTAAGGGGAAGTGCTATGGATTACACGCCTTCATTGTACCCATTCGTGAGATGGGAACCCACAAGCCTTTGCCAGGTATTACCGTTGGTGACATTGGCCCCAAATTTGGCTATGATGAGGTGGATAATGGTTACCTGAAGATGGACAGTTACCGTATTCCCAGAGAAAACATGCTGATGAAGTACGCCCAGGTGAAGCCCGACGGCACGTACGTGAAACCCGTGAGTAACAAGCTGACCTACGGGACCATGGTGTTTGTCAGGTCCCTCCTTGTGAAAGATGCCGCTCAGTGCCTATCGAAGGCGTGCACCATTGCCATCCGGTACAGCGCCGTGAGGCACCAGTCTGAAATCGAGCCAGGTGAACCAGAACCACAGATTTTGGATTTTCAGACCCAACAATATAAACTCTTTCCACTCCTGGCCACTGCCTATGCCTTCCATTTTGTGGGCGCATACATTAAGGAGACCTATCATCGGGTTAATGAGGACATTGGCCAAGGGGACCTGAGTGAGTTGCCCGAGCTTCACGCGCTCACTGCCGGGCTGAAGGCGTACACCACCTGGACGGCGAGCAGTGCTATTGAAGCTTGTCGGATGGCTTGTGGCGGCCACGGCTTTTCTCACTGCAGCGGTCTCCCCAGTATTTACGTCACTTTTACCCCAACCTGCACCTTCGAGGGAGAAAACACTGTCATGATGCTGCAGACGGCTAGGTTCCTGATGAAAAGCTATGACCAGGTGCGCTCAGGAAAGCTGCTGTGCGGCCTGGTGTCCTACTTGAACGACCTACCCAGTCAGCGCATCCAGCCACAGCAGGTGGCGGTCTGGCCGGCTGTGCTGGATATCAGCAGCCCCGACAGCCTGACGGAAGCGTATAAACTCCGAGCAGCCAGATTAGTAGAAATTGCTGCGAAAACCCTTCAAGCTGAACTGAGTCACAGAAAAAGTAAGGAGGTCGCTTGGAACCTCAGTTCCATCGACCTTGTTCGAGCAAGTGAGGCACATTGCCACTATGTGACAGTTAAGCTCTTTTCAGAAAAACTCCCCAAAATTCAAGATAAATCCATCCAAGCTGTCTTGAGGAATTTATGTCTCTTATATTCTCTGTACGGAATCAGTCAGAAGGCAGGGGATTTTCTTCAGGAGAGCATTCTGACAGACTCTCAAATTGCCCAAGTACACCAGCGTATCAAGGAGTTACTGACCGTCATTCGCCCAGATGCTGTTGCTTTGGTTGATGCGTTTGATTTTCAGGATATGTCACTGGGCTCTGTACTTGGCCGCTATGATGGGAATGTGTATGAGAACTTGTTTGAGTGGGCCAAGAAATCCCCACTAAACAAAGAAGAGGTCCATAAATCTTTCTACAAGTACCTGAAGCCTTTGCAGTCCAAACTCTGAATGTCACGACGAGTTTATTCTGCCCCAGGAAGCAGCTGTACTCTGCTGCTCCCCTGGTACCTGCCACACAAATCTACGCGGAATCTTTATCGAATTCGGAGAGCTATAGAGCAAATGATAAATTGGCCCCTTTCCCATCTATAAATAAAAAAATGAACAGCTTACAGAAATTAAATGAAAAAAACATGTTTTTAAGTGCAATTAACACTGAAAGAGACCCGTTAAGCATTCAGAAAAAGCTTTGAGAAATGTACTCTGACTTCCATATGTACAGCTGCTGATCCCAGGAGGCCATAACTTACGATAATTAGTAAAACTTAACTACTGAGTAGTTAATTATTTTCACATCTTAATTGCACATCACTGGATATATGTGTTTTTAAGCAAAGGTATTTTTAAAAGGGTACAACCCTTCCAAGTTTTCCTGCTTAGTGTCCCTGTCACTACTGTCATGGGCCTTGGCTTAAAAGCAGGACCCGAGGCTGGATTGGGGGAAAGAAACCAATCAGAAACTTTAGTGTGAGTTTGTGCTTAACTCATCTTCTGCCTGCTTGCCCTTGGTTGCTGACATAATGTTTCTGTTTGTTCATAGTAGCATTTTTCCTACACAGGGATTTCTTCAGCACAGAGCTACTACAGGGTCATTGTCCTATGTGACTGGGAATCGATCTTCCACTCGAAGGATCCTAAAATTGTCACTGTAGTAGCACTGCAACTCCCTGTGTCCCCAACTTCTAGTGGAGGGGTAGGTAGCAAAGTTATCTCTACATAGGACTTTTGGCAGCTAATGGGACTCAGTCAGTGGTGTTTGATCTCCCTCCATCCCTGTCCCTTAACCTCTCCTGAAAGAGATGCCGGAGGAGAAGAGAGTCACAGTTCCCTCCTAGTAGAATATGTATAGGGAAAGCTCTCGGTTACGGTTACGGTAACTTTGGGTACCATAGTAACTGGTAGATTTCATATATTCTGTTATATTGGCATAAACCATTAAAATGCTTGGAAGTTACAGTACCTTGCATTAGGAAAGTAAAATCATATTTCAGGTTAACTCTTAGACCCAGGGGTAGCACAGAAAAATCTTTTGACAAACCATGTGTTCTGATTTTTGGATCAGAAAATATAATCTTTGAAGGATAAAGGATAAATGGGACTTCCATAGGATCTCTTTCTTTTTTTCGTTTAGGTGAGGCAACACCCTTGGTGGACCTCACAGATTGCAAGGAACTTGTCAGCTTACAATCCCTTATT