Transcript asmbl_27358

Sequence
Transcript Sequence for observation asmbl_27358 of TGE0004667:
ATCATTCGTGTTCAGTCCCCGGATGGGGTGAAGCGGATCACGGCAACAAAGAGAGAGACAGCTGCGACGTTCCTGAAGAAGGTCGCAAAGGAGTTTGGCTTCCAGAATAATGGCTTCTCAGTTTACATCAATAGAAACAAGACCGGAGAGATAACAGCATCGTCCAACAAATCCCTCAACCTGCTAAAGATCAAGCATGGCGACTTGTTGTTCCTATTTCCCTCGAGCCTTGCCGGACCGTCATCTGAGATGGAGACGTCCACCCCGCCGGGCTTGAAGGCCCTGGGCGCGCCCACCGTGGTGGAAGATGAGATCGACCAGTACCTCAGCAGGCAGGACGGCAAGATCTACAGGAGCCGCGACCCGCAGCTATGCCGACACGGCCCTTTGGGGAAGTGCGTGCACTGCGTCCCTCTAGAGCCATTCGATGAGGACTACCTAAACCATCTCGAACCGCCCGTGAAGCACATGTCCTTCCACGCCTACATCCGAAAGCTGACCGGAGGGGCTGACAAGGGGAAGTTTGTCGCCCTTGAGAACATCAGTTGCAAGATTAAATCAGGGTGCGAGGGACACCTTCCGTGGCCTAATGGCATCTGTACTAAGTGCCAGCCGAGTGCCATCACGCTGAACAGACAGAAGTACCGACACGTGGACAACATCATGTTTGAGAACCACACGGTCGCTGACCGCTTCCTCGACTTCTGGCGGAGGACGGGGAGCCAGCATCTCGGGTACTTGTACGGGCGCTACACGGAGCACAAGGACATCCCTCTCGGCGTCAGGGCCGAGGTGGCGGCCATTTATGAGCCTCCTCAGATTGGTACACAGAACAGCTTGGAGCTCCTTGAAGACCCAAAAGCCGAGGTGGTGGATGAGATCGCTGCCAAACTTGGCCTGAGGAAGGTTGGCTGGATATTTACGGACCTTGTCTCAGAGGACACCCGAAAGGGCACAGTCCGATACAGCCGGAATAAGGACACCTATTTCTTGAGTGCAGAAGAATGTATCACTGCAGGAGACTTCCAAAATAAGCACCCCAACATATGTCGGCTCTCTCCAGACGGACACTTTGGATCCAAGTTCGTTACTGCTGTGGCTACAGGTGGCCCCGACAACCAGGTCCACTTTGAAGGGTACCAGGTGTCCAATCAGTGCATGGCGCTGGTCCGTGACGAGTGCCTGCTGCCGTGCAAGGACGCCCCTGAGCTCGGCTACGTCAAGGAGTCCAGCAGTGAGCAGTACGTGCCCGATGTGTTTTATAAGGACCTAGACAAGTTCGGCAACGAGATCACCCAGCTGGCCCGGCCCCTGCCCGTGGAGTACCTGATCATAGATATCACAACAACTTTCCCCAAGGATCCAGTTTATACTTTTTCTATTTCGCAAAATCCGTTTCCTATTGAAAACCGGGATGTGCTGGGTGAGACACAGGACTTCCACAGTTTGGCCACCTACTTGTCCCAGAGTACCTCAGCTGTATTTTTGGATACCATCTCGGATTTCCACCTCCTGCTGTTTCTGGTCACCAATGAAGTCATGCCTCTGCAGGACAGCATCAGCTTGCTGCTGGAGGCCGTGAGGACCAGGAACGAGGAGCTGGCGCAGACCTGGAAGAAGTCTGAGCAGTGGGCCACCATTGAGCAGCTCTGCAGCACAGTCGGAGTGCAGCTTCCGGGCCTCCAGGAGTACGGTGCCGTTGGGGGCCCCTCGCACGCCGCCGCGGCCGCCATGTGGGCCTGTCAGCACTGCACCTTCATGAACCAGCCGGGCACTGGCCACTGTGAGATGTGCAGCCTCCCCAGGACCTAGGGCTTCTGCCCCTGTGGCGGGGCCGGGCCCCTAGCCCTCCCTGAAGCCAGGACCTTTGTGACCGTGCCCCTTGGGCAGCCCTGAGGGGCGAGGCAAGGTAGCTGCCCCCCGGGTTCCTGATCCACAAGGCTTCTCAGCATCAGGCTTCCCTGGAGGAGGGCCCGGCTGGTGCTCTGCCAGCTGCTGGCAGCCACCTCGGGCAGGCGCAGCCCAGACACCTCTGGTGTCAGCCCCACCGTGGTGGAGGGACTGGCACCCCATCTTCACCCGGAGCGGAGGGGCGGGGCGCTCGCTGCTGCCTTGGCCTCCTTTCTCCTTCTGGATGCTTTCTGTTCTTGCCTCCCCCTGGTTTGGTGGGGGTCCCCCTTGGCCTCTCCATCCTGCTGCTCTGGGGCAGACCCTACCCTGAGGCCACTTCCTCCCTTCCCGGAGCCATCATCCGGTGGAAGTGCGAGTGGCCTCCGGCTCGCTGGCCTCCCTCTGCTTGATCTGCAGGTTGATTTGCTGCCCACCCTCTCTCCTGCTCCCGCCTGCCGTTCAGGTGGGATTTTAAAGTCGGCATTGGTTGTAATAACAGTTATTAGTAATTTCTGCCCAGAAGACTTTTATTTATTTTTTTTAAGATAAAAAATGCATAAAAGGGGAGTGAGAGAGACTAGTTTCCTCTTCCTTCTCTCCTCTAGTGAGTCCCCGTGGGTGTGTGCAGGGCGGGTGAGTGTGGCAGGGGACTCACAGTCAGTTCTCCATGGAAGCTAACCTCAGTGCCTGAGACTTTTCTGCCAAGCCACACAGCTGCAGGTACGGGCCGACCCAGCAGGAGTGGCGCGGTGGCTCCACCAGGCAGGTGGCTCCACCAGGCAGATGGCCCCTGCAGACGGCTGATGCCCCTGACCAGGCCCACATGGGGTGAGCCGAGTTAGCCAAGGTCAGAGCTCGGGTTCCCTTTGCCCCACACAGTCCCATAGCCCTGCCTGGCCCCTGGTCTCTGGCACAGTGACGTGGCCATCAAGAAAAGGAGCAGGGGCTTGACCTGTCGTGAGCGCACATGGGTCGGCTGTGGGGGCATCGGCAAGTTGCTGCTGTGCTGATGGAGTGAGGTCCGCACCCTCCCAGGACAGAGATCTGGGCAGACCTCGCACATGTGCCCTGTGGTCCCGCATTCTCTCCACGGCTGGGGTGTGTTCAGGCCCTTCCCCAGGGACTCGTGGGCATGCTGATGCCTCTTTGCCTTAACAAGAGCCGTATCTCTGAGCTGCCCCGCACCCATGGGAGAGGCCAACCAAACAGACTGCTTGGGGACTTCGGGTCTGCCCTGGGTTGGGGGCCAGCCTGTGGGACCCTCCCTTTCCCTCGGGGCTGTGCACAGAGCACTGAGTGTTGGCTTCTGCCCTAGTAAGGGCCACATCAGGCACCTCCGGGTCCACCCACCCAGACTCGTCTGCTCTTGGGGCCAGGGGCCAACTCGGCTGGGTCTGGCGGTGGCAGAGCAGCTGACCTGGAGGGGCCGGAAGGGCAGAGCAGCCCGGCAGAAGCGCAGCAGCCTGGCGAGGACTGGCTGGGGGCACTCTCAGCAGGTGCCCTGGCTGGAGCTCCTGCCTCATCTTCTGGTCCCTGCAATCAGATGCGAGGCCGCGCTGGGCCCTGCGTTCGGCCTGTCCCCCGGCGCCGGGGGAGGCCGGAGGTACCGGCTTCGAGAGCACCGGCCCCCCTCCCGCCTGCTCTGTCATCACCAAGCTAGTTTCGTTTTCAACCAATACTTCACTCGGAAGCTCTGGCATCGCATCATTCATTTGTTTCCTTCTGTCTTTTAGCTAAAGAAAAAGCTTTGTTGTGATTTC