Transcript asmbl_2731

Sequence
Transcript Sequence for observation asmbl_2731 of TGE0004782:
CCCCAGAGCCTCCGAGTTCCAACCGGTTCCTAATCTAGTTCCGCAGTCGTCCGCCTTTTCTTCCTTTTCAACATGACAGATGCCGCTGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTGGCTGCAGCCATCTCCAAGACGGCGGTAGCACCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAAATCACCGCAGATAAGCAGTACAAGGGCATTATAGACTGCGTGGTTCGTATCCCCAAGGAGCAGGGAGTACTATCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACCCAGGCTCTCAACTTTGCCTTCAAAGATAAATACAAGCAGATCTTCCTAGGTGGTGTGGACAAGAGAACCCAGTTCTGGCGCTACTTTGCAGGCAATCTGGCATCAGGTGGTGCCGCTGGGGCCACCTCCTTGTGTTTTGTGTATCCTCTTGATTTTGCCCGTACCCGTCTAGCTGCTGATGTGGGCAAAGCTGGAGCTGAAAGGGAATTCAAAGGCCTCGGTGACTGCCTGGTTAAGATCTACAAATCTGATGGGATTAGGGGCCTGTACCAAGGCTTTAATGTGTCCGTGCAGGGTATTATCATCTACCGAGCTGCCTACTTCGGTATCTATGACACTGCAAAGGGAATGCTTCCAGACCCCAAGAATACTCACATCTTCATCAGCTGGATGATTGCACAGTCCGTCACTGCGGTGGCTGGGTTAACTTCCTATCCATTTGACACTGTTCGTCGTCGCATGATGATGCAGTCAGGGCGCAAAGGAACTGATATCATGTACACGGGCACGCTCGACTGCTGGAGGAAGATTGCTCGTGATGAAGGAAGCAAAGCTTTTTTCAAGGGTGCATGGTCCAACGTTCTCAGAGGCATGGGTGGTGCTTTTGTGCTTCTCTTATATGATGAAATCAAGAAGTTCACATAAGTTATTTCCTAGTCTATTTTCCCCGTGAACAGGCATGTTGTGTTATGTAACATATCTTTGAGCATTCCTGACAGACTGTTGGCTATTTATCAGTGGCAACTATTTACTGGTTGAAAATGGGAAGCAATAATATTCATCCGACCAGTTTTCTCCTAAAGCTATTTCCATGATGATCATGATAATGATGGGACTCAATTATATTTTTTATTTCAGTCACTCCTAATAATAAATTTGAAGAAATAAAAAGTATCTGAAATACAA