Transcript asmbl_27209

Sequence
Transcript Sequence for observation asmbl_27209 of TGE0004643:
GGCGGGGATTGGCTTCTTCCTCGGCTCATAGCAGTTCGCGGCTGCAGTTCGTGGGACACCTGCTAGTTCCTCCGGCGCGGGGGCTTCTTGCCGCGCTCTCTCCAGCCTCCCGGTCCGCAGGGCTGGGTAAAGGGCTGGACCGTCCGGTCTCCGATCCCTTTACAGGACTCCGCGTCGCGCCGCTGAGCCGTCGCAGGGCGAGATGAGCGCGGACGCAGCGGCCGGGGCGCCCCTGCCCCGGCTCTGCTGCCTGGAGAAGGGTCCGAACGGCTATGGCTTCCACCTGCACGGGGAGAAGGGCAAGGTGGGCCAGTTCATCCGGCTGGTGGAACCCGGCTCGCCAGCCGAGAGGTCGGGGCTGCTGGCCGGAGACCGGCTCGTGGAGGTGAACGGCGAGAACGTAGAGAAGGAGACCCACCAGCAGGTGGTGAGCCGCATCCGCGCGGCGCTCAACGCCGTGCGTCTGCTGGTGGTCGACCCCGAGACGGACGAGCGGCTGCAGAAGCTGGGCGTCCAGGTCCGGGAGGAGCTGCTGCGCACCCAGGAAGGGCCCTCGCAGGCCGAGCCGCCGGCCGCCGCCGAGGCGCAGGGGGCTGGCGACGAAAATGAGCCACAGGCCGCCGCGCCGGAACCGGGGGAGGCGGAGAAGAGCCATCCGGAGCTGCGTGAGCTTCGGCCTCGGCTCTGCACCATGAAGAGGGGCGCCAACGGCTATGGCTTCAACCTGCACAGCGACAAGTCCAAGCCAGGCCAGTTCATCCGGTCAGTGGACGCAGACTCGCCCGCCGAAGCCTCAGGGCTCCAGGCCCAGGATCGCATCGTAGAGGTGAACGGGGTCTGCATGGAGGGCAAGCAGCACGGGGACGTGGTATCTGCCATCAAGGCTGGTGGGGACGAGACCAAGCTGCTGGTGGTGGACAGAGAGACCGATGAGTTCTTCAAGAAGTGCAAAGTGATCCCATCTCAGGAGCATCTGAATGGTCCCTTGCCTGAGCCCTTCACCAATGGGGAGATCCAGAAGGAGGCGGCCTCCGAGAACCCCAGACCGATGCTGGCAAGGTCCACCTCCAGTGACACCAGTGAAGAGCTGAATTCTCAAGACAGCCCCAAGGAACAGGACCCCACGGCACCCTCATCTACCTCTTCCTCCTCCGACCCCATCCCGGACTTCACCATCTCCCTGGCCGCGGCCAAAGAGAGGGCCCACCAGAAGCGCGGCAACAAGCGGGCCCCGCAGATGGACTGGAGCAAGAAAAACGAACTCTTCAGCAACCTCTGAGCGCGTCCCCCGGCCACCCGGGAAAGCTGGAGGGCTGGGCCCACACCCCAACTCAGCCCCCTTCCCCTCCCCGCCCCCCACTCACCCACGAATGACTTACAAATCAGCACCAGCATCTCCCCTCTTGGCCAATCTGATTTTTCTAGAGAACTACATGAATGTTTGCCTTTCCTACTCCAATCAAAGAGCAGACTGTCCCCCTCCTCGCAGAGGGCTTCAGCCCACCAGGTGTCTGCTCGCCACCCCTCCCGGGACATCACTGGGAGCTACACCATGCAAGGACCATGGGACTGGGAGAGGGGTCACGGCCTCAAGTGATGACTGGGCCCAGGGTTGGAGGACTTGGATTACAGCAGTAAGCACCTCATCCTGAGAGGGCTGGGTTGGGCATCTTATTTTCGT