Transcript asmbl_27056

Sequence
Transcript Sequence for observation asmbl_27056 of TGE0004615:
TTTGAACCCGGGGCGGGGGCGGCGGCGGGAGCCGAGGTCGGGGTCGGGATTAGTGTCCGCGTCTGGATCCGGCCCGGGCCGCCGGCACTCCTGGGCGTCCGCTTCCGGGCATGGCGGCCGAGGTGCGCGTTTCGCGCTGGTACTTCGGGGGCCTGGCCTCGTGTGGGGCAGCCTGCTGCACGCACCCGCTGGACCTGCTCAAGGTGCACCTGCAGACGCAGCAGGAGGTGAAGCTGCGCATGACCGGCATGGCGCTGCAGGTGGTGCGCTCCGACGGCATCCTGGCGCTCTACAACGGCCTGAGCGCCTCCCTGTGCAGACAGATGACCTACTCCCTGACCCGATTCGCCATCTACGAGACCGTGCGTGACCAGGTGGCCCAGGGCAGCCAGGGGCCCCTGCCCTTCTACAAGAAGGTGTTGCTGGGTTCCCTCAGTGGTTGCATCGGAGGTCTCGTGGGGACTCCCGCTGACATGGTCAACGTCAGGATGCAGAACGACATGAAGCTGCCCCAGGATCAGCGCCGAAACTACGCGCACGCCCTGGACGGCCTGTACCGTGTGGCCCGAGAAGAGGGTCTGAAGAAGCTGTTCTCGGGTGCGACCATGGCGTCTAGTCGAGGGATGTTGGTGACCGTGGGCCAGCTGTCCTGCTATGACCAGGCCAAGCAGCTCGTCCTCAGCATGGGGTACCTGTCTGACGGCATCGTCACTCACTTCATCGCCAGCTTCATCGCAGGTGGGTGTGCCACGTTTCTGTGCCAGCCGCTGGACGTGCTGAAGACCCGTCTGATGAACTCCAAGGGCGAGTATCAGGGCGTTCTCCACTGCACCATGGAGACTGCGAAACTCGGGCCAATGGCCTTTTACAAGGGCCTCTTGCCCGCCGGCATCCGCCTCATGCCCCACACCGTGCTCACGTTCGTGTTTCTGGAACAGCTTCGCAAACACTTTGGCATCAAAGTGCCGTCCTGATGGGGCCGTGGGAGCGAGCTGGGCCGTGCTGGCCCCCAGTGCCAGTTCTTCCACAGTCCCGGCAAGCCAAGCGCTGCCCTAAGCCCAGCACCTGCCCGCAGGGCTCCAGCCCCCCATTCCTGGCCCAGGACGCCCACCCCGTCCTCCCCCACCTGCCTGGGCTGGAGCTCCTTCCAGGAGCTGTCCCCCCAGCACCCCTCCGCTGTAGCTTCGCCTTGGCCCTCCCTACCTGGCACCCCAGTGGCCCCATCCACGCACCTGTGCCTCACTGGGAGGGGCGGGCTCCAAGTGCAGGTTCAGGCTTCTCCCCTCCCCGAGCAGTCAGCCCTGGCGGGGGAGGGGCAGGCTCCAGGCTTTCTGGGGTCCCCCGCCCCTTCGCCTGAGGCGTTTCTTTCACCGAGCAGCTGCCCAGGGCTCACAGCACCGTCTTCCAGCAGCTTCTTTCAAGGACCTGGGAGGCAGAGCGGGGGGAGTGCAGACCCCCAGCATTGCCCACCAAAGCGTGTGCCTGCACGCGCACTTTATCCTAGGAAAGGGACCATAGCTTTCGTGACGTTCTCGAAGGTAGCTGTGCCCCTGCGCTGCTGGGCAGGTGGCGGAGGAGGCAGGGAACGCAGGGTCTGAGCTGTGGGCCCCTCAGGCCCGTCCCGCCCCAGCCAACCCCCTGTTGCTCTAAGGGTTAGTTTCACCAAAAACCTCAGCGCCAGAGGCGCTGCTGTCTGCAGGGAGCGGAGTGTCTCTCACACCGTCCACGCTGTCCCCTCCGGCCCCCGGGGCAGAGGCGGGCTGTGCCGCGTCCTCGGGGCCCCTCTCTCTGTGGACAGCGATCACCCTTCAGGGCCCCCAGCAGCTGACCAGCCAAAACACCGCCGCCCAGGTTCTGCTGCCAGAGCAGCCTGACCCTGCAAATGGGCCTAGGGACTGTGTCTTCACCCCGGTAGGGGGCCGGCCCACAGGGACACTAATAAAGGACAGGAGCTGC