Transcript asmbl_26255

Sequence
Transcript Sequence for observation asmbl_26255 of TGE0015407:
CGGGTATAAAGTGAGAAGACATCTGCGTGCTGCCCCTCCTGTCCGCAGCCTGCAGTCCCGGTTCCGCGCCGCCCACTCACCTGCACCCGACCTGCTTGTGCCCAGATCGCTGGTAGCTCATTGCACCATGTGTGGCATTTGGGCTCTCTTTGGCAGCGATGACTGCCTTTCTGTTCAGTGTCTGAGTGCTATGAAGATTGCACACAGGGGTCCAGATGCATTTCGTTTTGAGAATGTCAATGGATACACCAACTGCTGCTTTGGATTTCACCGGTTGGCAGTGGTCGACCCCCTGTTTGGAATGCAGCCAATTCGACTGAAGAAATATCCTTATTTATGGCTCTGTTACAATGGTGAAATCTACAACCACCAGAAGCTGCAACGCCATTTTGAATTTGAATATCAGACCAAAGTGGATGGTGAGATAATCCTTCATCTTTATGACAAAGGAGGAATTGAACAAACGATTTGTATGTTGGATGGGGTATTTGCATTTATTTTACTGGATACAGCCAATAAGAAAGTGTTCCTGGGCAGAGACACCTATGGAGTCAGACCTTTGTTTAAAGCAATGACAGAAGATGGATTTTTGGCCGTATGTTCAGAAGCTAAAGGTCTTGTTAACTTAAAGCACTCCACAGCTCCTTTTTTAAAAGTGGAGCCGTTTCTTCCTGGGCACTATGAAGTCTTGGATTTAAAGCCAAATGGCAAAGTTGCGTCGGTGGAAATGGTTAAATACCATCACTGCAGAGATGAGCCCCTGCATGCCCTCTATGACAATGTGGAGAAACTGTTTCCTGGTTTTGAGATAGAAACTGTGAAGAGCAACCTCCGGATCCTTTTTGACAATGCTGTTAAGAAACGTTTGATGACGGACAGAAGGATTGGCTGCCTTTTATCAGGGGGCTTGGATTCCAGTTTGGTTGCTGCCACCCTGTTGACGCAGCTCAAAGCGGCCCAAGTACAGTACCCCCTGCAGACATTTGCGATTGGCATGGAAGACAGTCCTGATTTACTGGCTGCTAGAAAGGTGGCAAATCATATTGGGAGTGAACATCACGAAGTCCTCTTCAACTCAGAGGAAGGTATTCAGGTCCTGGACGAAGTCATATTTTCCTTGGAAACTTATGACATTACAACAGTGCGTGCTTCAGTCGGTATGTACTTAATTTCTAAGTACATTCGAAAGAACACAGATAGCGTGGTCATCTTCTCTGGAGAAGGTTCAGATGAACTCACTCAGGGTTACATATATTTTCACAAGGCCCCTTCTCCTGAAAAAGCCGAGGAGGAGAGTGAGAGGCTTCTGAAGGAACTCTATTTGTTTGATGTTCTCCGCGCAGATCGAACTACTGCTGCCCATGGCCTTGAATTGAGAGTCCCATTCCTGGATCATCGGTTTTGTTCCTATTACTTGTCTCTGCCACCAGATATGAGAATTCCCAAGAATGGGATAGAAAAACATCTCCTGAGAGAGACATTTGAAGACTCTAATCTGCTACCTAAAGAGATTCTCTGGCGACCGAAAGAAGCCTTCAGTGATGGCATAACCTCAGTCAAGAATTCCTGGTTTAGGATTTTACAGGAATATATTGAACATCAGGTCGACGATGCAACGATGGCAGCTGCAGCCCAAAAATTTCCCTTCAATACTCCTAAAACTAAAGAAGGCTATTACTACCGTCAGATCTTTGAACGCCATTACCCAGGCCGGGCTGACTGGCTGACCCATTACTGGATGCCCAGGTGGATCAATGCCACTGACCCTTCTGCCCGCACTCTGACCCATTACAAGTCAGCCGCCAAAGCTTAGGCCCTCTCTAAGCAATGGAGTGAAAGTAAATGTTTCTTCTTCTTATGAGGGGTAGGGGACTTGGGGTCAGGCAGGGGAACGAAGAGGATCAATCAGGCAGGCTTGCTTGGGGGTGAAAAAAATAAAAGTCTTAAATCTGAAA