Transcript asmbl_26128

Sequence
Transcript Sequence for observation asmbl_26128 of TGE0004565:
GAATCGCCGCAGCTCCCAGCCTCGCGCGTCGCCGCTACCTTCTCGGACAGGTGAGAAGCAACCCAGAAATTTTATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGATGAAAAAGAGAAATTCGAACCTACAGTCTTCAGGGATACACTTGTCCAGGGGCTTAATGAAGCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCTACAGGATCAAGATTAGATTATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCTGGAGGGACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCAGCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAACTCATCAGGAGATACAAGTATTTGGAAAAGGCATTTGAGGACGAAATGAAAAAGCTTCTCCTCTTCCTTAAAGCCTTTTCCGAAACAGAGCAGACCAAGCTGGCGATGCTGTCAGGCATCCTGCTGGGCAACGGCACCCTTCCTGCCGCCATCCTCACCAGTCTCTTCACCGACAGCTTAGTCAAAGAAGGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGGATGGCAGAAAAAGATGCCAACTCTGTTACCTCTTCTTTGAGAAAAGCCAACTTAGACAAGAGGCTGCTTGAACTCTTTCCAGTTAACAGACAGAGTGTGGATCATTTTGCTAAATACTTCACAGACGCAGGACTAAAGGAGCTTTCTGATTTCCTGCGAGTCCAGCAGCCCCTGGGCACCAGGAAGGAACTGCAGAAGGAGCTCCAGGAGGAGCGTCTTTCAGTGATGCCCGATCAAGGAGGTGGTGCTCTATGTGAAAGAAGAAATGAAGAGGAATGACCTTCCGGAAACAGCAGTGATTGGACTTCTGTGGACCTGTATCATGAATGCTGTTGAATGGAACAAGAAGGAGGAACTCGTGGCAGAGCAGGCCCTTAAGCACCTGAAGCAATACGCTCCCCTGCTGGCTGTGTTCAGCTCCCAAGGCCAGTCAGAGCTGATCCTTCTCCAGAAGGTTCAGGAATACTGTTACGACAACATCCATTTCATGAAAGCCTTTCAGAAGATCGTGGTTCTCTTTTACAAAGCCGATGTGCTGAGTGAAGAAGCAATTTTGAAATGGTACAAAGAAGCACACGTGGCCAAAGGCAAAAGTGTTTTTCTTGACCAGATGAAGAAATTTGTTGAGTGGTTACAAAATGCAGAAGAAGAATCCGAATCGGAAGGTGAGGAAAATTAGATGACTCGAGAAGCACAATACCTAGGGTTACTACACAATACTTTGATTGGGAATGCTGAACCATTCGAGAAGAGAAACTTGGCTTCTGTTTTCACAAAGGATTAAAAATAGGATAGGGTTCCCTTGTGCAGAAGGGGAAAAGTGGTTTTGTTTTCATTTTGTTTTTAAATGGAGCCCTGAGGCATCAGCTATTACACTTGGGACTCTACCTCTCACTCACTGTATGCTAACTTAAAGCCATTCAACAAGGAGTCAAGTAGGAATCTGAAAGTAAATACTCAACGGACTCCTCTTTTTTAGCTGTATTTTTCAGGTACTGTGTGGTGAATGCCCCACTGGTGTCTATTACAGGGCCACTTTGGTAGTTGTGTATCTGCTCGTGTATGTGATTTGACAAACCAGTTTTTTTAAATAAATGGCTTTATAAAAA